EMAIL THIS PAGE TO A FRIEND

ABCB8

ATP-binding cassette, sub-family B (MDR/TAP), member 8

49 Gene Product Result for
Synonyms: EST328128 M-ABC1 MABC1
UniProtKB ID: Q9NUT2, B2RBL8, O95787, Q53GM0
Gene ID:
Human(11194) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. The function of this half-transporter has not yet been determined; however, it may involve the compartmentalization and transport of heme, as well as peptides, from the mitochondria to the nucleus and cytosol. This protein may also play a role in the transport of phospholipids into mitochondrial membranes. [provided by RefSeq, Jul 2008]
Mouse(74610) ATP-binding cassette, sub-family B (MDR/TAP), member 8
Rat(362302) ATP-binding cassette, subfamily B (MDR/TAP), member 8
naked mole-rat(101709440) ATP-binding cassette, sub-family B (MDR/TAP), member 8
domestic guinea pig(100730355) ATP-binding cassette, sub-family B (MDR/TAP), member 8
sheep(101103060) ATP-binding cassette, sub-family B (MDR/TAP), member 8
Domestic Rabbit(100351012) ATP-binding cassette, sub-family B (MDR/TAP), member 8
Zebrafish(548340) ATP-binding cassette, sub-family B (MDR/TAP), member 8
cow(511548) ATP-binding cassette, sub-family B (MDR/TAP), member 8
domestic cat(101081882) ATP-binding cassette, sub-family B (MDR/TAP), member 8
dog(482800) ATP-binding cassette, sub-family B (MDR/TAP), member 8
chicken(101750604) ATP-binding cassette, sub-family B (MDR/TAP), member 8
chicken(101665557) ATP-binding cassette, sub-family B (MDR/TAP), member 8
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007188 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007188 Rosetta Predictions human pricing
NM_001007796 Rosetta Predictions rat pricing
NM_029020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205576 predicted 783
2 SASI_Hs01_00205577 predicted 607
3 SASI_Hs02_00343156 predicted 1005
4 SASI_Hs02_00343157 predicted 2620
5 SASI_Hs01_00205579 predicted 1294
6 SASI_Hs01_00205580 predicted 580
7 SASI_Hs01_00205582 predicted 638
8 SASI_Hs01_00205583 predicted 2135
9 SASI_Hs01_00205584 predicted 1448
10 SASI_Hs02_00343158 predicted 1710
11 SASI_Hs01_00205575 predicted 1176
12 SASI_Hs01_00205578 predicted 412
13 SASI_Hs01_00205581 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035695 predicted 334
2 SASI_Rn01_00035696 predicted 962
3 SASI_Rn01_00035697 predicted 700
4 SASI_Rn01_00035698 predicted 1096
5 SASI_Rn01_00035699 predicted 1659
6 SASI_Rn01_00035700 predicted 689
7 SASI_Rn01_00035701 predicted 1678
8 SASI_Rn01_00035702 predicted 1631
9 SASI_Rn01_00035703 predicted 265
10 SASI_Rn02_00198957 predicted 1404
11 SASI_Rn01_00035704 predicted 1780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064431 predicted 672
2 SASI_Mm01_00064432 predicted 343
3 SASI_Mm01_00064433 predicted 1438
4 SASI_Mm01_00064434 predicted 1029
5 SASI_Mm01_00064435 predicted 2269
6 SASI_Mm01_00064436 predicted 1679
7 SASI_Mm01_00064438 predicted 609
8 SASI_Mm01_00064439 predicted 1973
9 SASI_Mm02_00334770 predicted 808
10 SASI_Mm01_00064440 predicted 1280
11 SASI_Mm01_00064437 predicted 1072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007188
VALIDATED
ABCB8 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 8
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_007188.2-307s1c1
Sequence:CCGGCCCATGGTACTGAGTAAGCATCTCGAGATGCTTACTCAGTACCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_007188.2-1350s1c1
Sequence:CCGGCTTTGAGTACATGGCCCTGAACTCGAGTTCAGGGCCATGTACTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007188.2-1785s1c1
Sequence:CCGGTCACGAGTTCATCACCAGTTTCTCGAGAAACTGGTGATGAACTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007188.2-1167s1c1
Sequence:CCGGCGCCTTCAACTGCATGGTCTTCTCGAGAAGACCATGCAGTTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_007188.2-734s1c1
Sequence:CCGGTCACCTTCTTTGACGCCAATACTCGAGTATTGGCGTCAAAGAAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-602s21c1
Sequence:CCGGTCATGACTGAGTCCCAGAATCCTCGAGGATTCTGGGACTCAGTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-1445s21c1
Sequence:CCGGTGCGTGGCTCCGTTACATTTCCTCGAGGAAATGTAACGGAGCCACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-1770s21c1
Sequence:CCGGTTCCGATGAAGAGGTGTACACCTCGAGGTGTACACCTCTTCATCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-1319s21c1
Sequence:CCGGCCAACCTCTCTGTCCTGTTTGCTCGAGCAAACAGGACAGAGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-1803s21c1
Sequence:CCGGAGCGAATGCTCACGAGTTCATCTCGAGATGAACTCGTGAGCATTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-811s21c1
Sequence:CCGGACTGACGTGCAGGAGTTTAAGCTCGAGCTTAAACTCCTGCACGTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007188
VALIDATED
ABCB8 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 8
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_007188.2-307s1c1
Sequence:CCGGCCCATGGTACTGAGTAAGCATCTCGAGATGCTTACTCAGTACCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_007188.2-1350s1c1
Sequence:CCGGCTTTGAGTACATGGCCCTGAACTCGAGTTCAGGGCCATGTACTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007188.2-1785s1c1
Sequence:CCGGTCACGAGTTCATCACCAGTTTCTCGAGAAACTGGTGATGAACTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007188.2-1167s1c1
Sequence:CCGGCGCCTTCAACTGCATGGTCTTCTCGAGAAGACCATGCAGTTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_007188.2-734s1c1
Sequence:CCGGTCACCTTCTTTGACGCCAATACTCGAGTATTGGCGTCAAAGAAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-602s21c1
Sequence:CCGGTCATGACTGAGTCCCAGAATCCTCGAGGATTCTGGGACTCAGTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-1445s21c1
Sequence:CCGGTGCGTGGCTCCGTTACATTTCCTCGAGGAAATGTAACGGAGCCACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-1770s21c1
Sequence:CCGGTTCCGATGAAGAGGTGTACACCTCGAGGTGTACACCTCTTCATCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-1319s21c1
Sequence:CCGGCCAACCTCTCTGTCCTGTTTGCTCGAGCAAACAGGACAGAGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-1803s21c1
Sequence:CCGGAGCGAATGCTCACGAGTTCATCTCGAGATGAACTCGTGAGCATTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-811s21c1
Sequence:CCGGACTGACGTGCAGGAGTTTAAGCTCGAGCTTAAACTCCTGCACGTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007188
VALIDATED
ABCB8 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 8
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_007188.2-307s1c1
Sequence:CCGGCCCATGGTACTGAGTAAGCATCTCGAGATGCTTACTCAGTACCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_007188.2-1350s1c1
Sequence:CCGGCTTTGAGTACATGGCCCTGAACTCGAGTTCAGGGCCATGTACTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007188.2-1785s1c1
Sequence:CCGGTCACGAGTTCATCACCAGTTTCTCGAGAAACTGGTGATGAACTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007188.2-1167s1c1
Sequence:CCGGCGCCTTCAACTGCATGGTCTTCTCGAGAAGACCATGCAGTTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_007188.2-734s1c1
Sequence:CCGGTCACCTTCTTTGACGCCAATACTCGAGTATTGGCGTCAAAGAAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-602s21c1
Sequence:CCGGTCATGACTGAGTCCCAGAATCCTCGAGGATTCTGGGACTCAGTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-1445s21c1
Sequence:CCGGTGCGTGGCTCCGTTACATTTCCTCGAGGAAATGTAACGGAGCCACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-1770s21c1
Sequence:CCGGTTCCGATGAAGAGGTGTACACCTCGAGGTGTACACCTCTTCATCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-1319s21c1
Sequence:CCGGCCAACCTCTCTGTCCTGTTTGCTCGAGCAAACAGGACAGAGAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-1803s21c1
Sequence:CCGGAGCGAATGCTCACGAGTTCATCTCGAGATGAACTCGTGAGCATTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007188.3-811s21c1
Sequence:CCGGACTGACGTGCAGGAGTTTAAGCTCGAGCTTAAACTCCTGCACGTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029020
ABCB8 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029020.2-2806s1c1
Sequence:CCGGGCCTGGTAGAATGGGTTGTAACTCGAGTTACAACCCATTCTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029020.2-994s1c1
Sequence:CCGGCCGGCAAGACATTGCTTTCTTCTCGAGAAGAAAGCAATGTCTTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029020.2-995s1c1
Sequence:CCGGCGGCAAGACATTGCTTTCTTTCTCGAGAAAGAAAGCAATGTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029020.2-606s1c1
Sequence:CCGGGCCTCTGCCTTATAGCACTATCTCGAGATAGTGCTATAAGGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029020.2-2386s1c1
Sequence:CCGGCGGGCTCTATTCAGAGCTTATCTCGAGATAAGCTCTGAATAGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029020.2-2360s21c1
Sequence:CCGGACCCACGAAGAACTCCTTAAACTCGAGTTTAAGGAGTTCTTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029020.2-2759s21c1
Sequence:CCGGTGCCCAACACTCAGTTGTTTGCTCGAGCAAACAACTGAGTGTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029020.2-995s21c1
Sequence:CCGGCGGCAAGACATTGCTTTCTTTCTCGAGAAAGAAAGCAATGTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029020.2-606s21c1
Sequence:CCGGGCCTCTGCCTTATAGCACTATCTCGAGATAGTGCTATAAGGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029020.2-1979s21c1
Sequence:CCGGATCATGGAGAATATCCGATTTCTCGAGAAATCGGATATTCTCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029020
ABCB8 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029020.2-2806s1c1
Sequence:CCGGGCCTGGTAGAATGGGTTGTAACTCGAGTTACAACCCATTCTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029020.2-994s1c1
Sequence:CCGGCCGGCAAGACATTGCTTTCTTCTCGAGAAGAAAGCAATGTCTTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029020.2-995s1c1
Sequence:CCGGCGGCAAGACATTGCTTTCTTTCTCGAGAAAGAAAGCAATGTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029020.2-606s1c1
Sequence:CCGGGCCTCTGCCTTATAGCACTATCTCGAGATAGTGCTATAAGGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029020.2-2386s1c1
Sequence:CCGGCGGGCTCTATTCAGAGCTTATCTCGAGATAAGCTCTGAATAGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029020.2-2360s21c1
Sequence:CCGGACCCACGAAGAACTCCTTAAACTCGAGTTTAAGGAGTTCTTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029020.2-2759s21c1
Sequence:CCGGTGCCCAACACTCAGTTGTTTGCTCGAGCAAACAACTGAGTGTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029020.2-995s21c1
Sequence:CCGGCGGCAAGACATTGCTTTCTTTCTCGAGAAAGAAAGCAATGTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029020.2-606s21c1
Sequence:CCGGGCCTCTGCCTTATAGCACTATCTCGAGATAGTGCTATAAGGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029020.2-1979s21c1
Sequence:CCGGATCATGGAGAATATCCGATTTCTCGAGAAATCGGATATTCTCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029020
ABCB8 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029020.2-2806s1c1
Sequence:CCGGGCCTGGTAGAATGGGTTGTAACTCGAGTTACAACCCATTCTACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029020.2-994s1c1
Sequence:CCGGCCGGCAAGACATTGCTTTCTTCTCGAGAAGAAAGCAATGTCTTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029020.2-995s1c1
Sequence:CCGGCGGCAAGACATTGCTTTCTTTCTCGAGAAAGAAAGCAATGTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029020.2-606s1c1
Sequence:CCGGGCCTCTGCCTTATAGCACTATCTCGAGATAGTGCTATAAGGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029020.2-2386s1c1
Sequence:CCGGCGGGCTCTATTCAGAGCTTATCTCGAGATAAGCTCTGAATAGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029020.2-2360s21c1
Sequence:CCGGACCCACGAAGAACTCCTTAAACTCGAGTTTAAGGAGTTCTTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029020.2-2759s21c1
Sequence:CCGGTGCCCAACACTCAGTTGTTTGCTCGAGCAAACAACTGAGTGTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029020.2-995s21c1
Sequence:CCGGCGGCAAGACATTGCTTTCTTTCTCGAGAAAGAAAGCAATGTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029020.2-606s21c1
Sequence:CCGGGCCTCTGCCTTATAGCACTATCTCGAGATAGTGCTATAAGGCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029020.2-1979s21c1
Sequence:CCGGATCATGGAGAATATCCGATTTCTCGAGAAATCGGATATTCTCCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks