EMAIL THIS PAGE TO A FRIEND

ABCB9

ATP-binding cassette, sub-family B (MDR/TAP), member 9

120 Gene Product Result for
Synonyms: EST122234 TAPL
Gene ID:
Human(23457) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This family member functions in the translocation of peptides from the cytosol into the lysosomal lumen. Alternative splicing of this gene results in distinct isoforms which are likely to have different substrate specificities. [provided by RefSeq, Jul 2011]
Mouse(56325) ATP-binding cassette, sub-family B (MDR/TAP), member 9
Rat(63886) ATP-binding cassette, subfamily B (MDR/TAP), member 9
Zebrafish(570148) ATP-binding cassette, sub-family B (MDR/TAP), member 9
chicken(416834) ATP-binding cassette, sub-family B (MDR/TAP), member 9
dog(477456) ATP-binding cassette, sub-family B (MDR/TAP), member 9
cow(529923) ATP-binding cassette, sub-family B (MDR/TAP), member 9
domestic cat(101088115) ATP-binding cassette, sub-family B (MDR/TAP), member 9
sheep(101119252) ATP-binding cassette, sub-family B (MDR/TAP), member 9
domestic guinea pig(100722499) ATP-binding cassette, sub-family B (MDR/TAP), member 9
naked mole-rat(101716118) ATP-binding cassette, sub-family B (MDR/TAP), member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019624 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019624 Rosetta Predictions human pricing
NM_019625 Rosetta Predictions human pricing
NM_203444 Rosetta Predictions human pricing
NM_203445 Rosetta Predictions human pricing
NM_022238 Rosetta Predictions rat pricing
NM_019875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352839 predicted 1206
2 SASI_Hs02_00352840 predicted 940
3 SASI_Hs01_00019214 predicted 425
4 SASI_Hs01_00019215 predicted 1945
5 SASI_Hs02_00352841 predicted 1017
6 SASI_Hs01_00019216 predicted 2036
7 SASI_Hs01_00019218 predicted 2192
8 SASI_Hs01_00019219 predicted 2822
9 SASI_Hs01_00019221 predicted 2718
10 SASI_Hs02_00352842 predicted 1061
11 SASI_Hs01_00019212 predicted 2683
12 SASI_Hs01_00019213 predicted 2814
13 SASI_Hs01_00019217 predicted 553
14 SASI_Hs01_00019220 predicted 2802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352843 predicted 1211
2 SASI_Hs02_00352844 predicted 937
3 SASI_Hs01_00079551 predicted 424
4 SASI_Hs01_00079552 predicted 2075
5 SASI_Hs02_00352845 predicted 1023
6 SASI_Hs01_00079553 predicted 2157
7 SASI_Hs01_00079555 predicted 2316
8 SASI_Hs01_00079556 predicted 2948
9 SASI_Hs01_00079558 predicted 2840
10 SASI_Hs02_00352846 predicted 1052
11 SASI_Hs01_00079549 predicted 2808
12 SASI_Hs01_00079550 predicted 2945
13 SASI_Hs01_00079554 predicted 553
14 SASI_Hs01_00079557 predicted 2928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373371 predicted 1474
2 SASI_Hs02_00373372 predicted 1203
3 SASI_Hs01_00040999 predicted 688
4 SASI_Hs01_00041000 predicted 2345
5 SASI_Hs02_00373373 predicted 1292
6 SASI_Hs01_00041001 predicted 2430
7 SASI_Hs01_00041003 predicted 2589
8 SASI_Hs01_00041004 predicted 3216
9 SASI_Hs01_00041006 predicted 3113
10 SASI_Hs02_00373374 predicted 1327
11 SASI_Hs01_00040997 predicted 3098
12 SASI_Hs01_00040998 predicted 3240
13 SASI_Hs01_00041002 predicted 849
14 SASI_Hs01_00041005 predicted 3223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107823 predicted 397
2 SASI_Hs01_00107824 predicted 1333
3 SASI_Hs01_00107825 predicted 1574
4 SASI_Hs01_00107826 predicted 1175
5 SASI_Hs01_00107827 predicted 922
6 SASI_Hs01_00107828 predicted 1490
7 SASI_Hs01_00107829 predicted 1375
8 SASI_Hs01_00107830 predicted 1127
9 SASI_Hs01_00107831 predicted 1580
10 SASI_Hs01_00107832 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045924 predicted 952
2 SASI_Rn01_00045925 predicted 282
3 SASI_Rn01_00045926 predicted 2231
4 SASI_Rn01_00045927 predicted 921
5 SASI_Rn01_00045929 predicted 748
6 SASI_Rn01_00045930 predicted 1623
7 SASI_Rn01_00045931 predicted 328
8 SASI_Rn02_00263012 predicted 333
9 SASI_Rn01_00045932 predicted 1232
10 SASI_Rn01_00045933 predicted 1546
11 SASI_Rn01_00045928 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039108 predicted 979
2 SASI_Mm01_00039109 predicted 786
3 SASI_Mm01_00039110 predicted 1901
4 SASI_Mm01_00039111 predicted 853
5 SASI_Mm01_00039112 predicted 2256
6 SASI_Mm01_00039113 predicted 519
7 SASI_Mm01_00039114 predicted 354
8 SASI_Mm01_00039115 predicted 935
9 SASI_Mm01_00039116 predicted 978
10 SASI_Mm01_00039117 predicted 1254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019875
ABCB9 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019875.2-595s21c1
Sequence:CCGGTCTTCGTGTGGACCTACATCTCTCGAGAGATGTAGGTCCACACGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019875.2-942s21c1
Sequence:CCGGAGCTCATTGGCCGCAGGTATTCTCGAGAATACCTGCGGCCAATGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019875.2-2793s21c1
Sequence:CCGGGCAAGCTCACTAAGATGTTTCCTCGAGGAAACATCTTAGTGAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019875.2-2644s1c1
Sequence:CCGGCCCTTCTACTGTGTCCTTCTTCTCGAGAAGAAGGACACAGTAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019875.2-980s1c1
Sequence:CCGGCCTCGTATTTGCCAGACTGAACTCGAGTTCAGTCTGGCAAATACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019875.2-1566s1c1
Sequence:CCGGGCCTTCATCATCTACGAATTTCTCGAGAAATTCGTAGATGATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019875.2-1910s1c1
Sequence:CCGGCCGTGTATTGTTGGATGGCAACTCGAGTTGCCATCCAACAATACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019875.2-1496s1c1
Sequence:CCGGCCAGGTCAGTATTCTCTACTACTCGAGTAGTAGAGAATACTGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019875
ABCB9 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019875.2-595s21c1
Sequence:CCGGTCTTCGTGTGGACCTACATCTCTCGAGAGATGTAGGTCCACACGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019875.2-942s21c1
Sequence:CCGGAGCTCATTGGCCGCAGGTATTCTCGAGAATACCTGCGGCCAATGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019875.2-2793s21c1
Sequence:CCGGGCAAGCTCACTAAGATGTTTCCTCGAGGAAACATCTTAGTGAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019875.2-2644s1c1
Sequence:CCGGCCCTTCTACTGTGTCCTTCTTCTCGAGAAGAAGGACACAGTAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019875.2-980s1c1
Sequence:CCGGCCTCGTATTTGCCAGACTGAACTCGAGTTCAGTCTGGCAAATACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019875.2-1566s1c1
Sequence:CCGGGCCTTCATCATCTACGAATTTCTCGAGAAATTCGTAGATGATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019875.2-1910s1c1
Sequence:CCGGCCGTGTATTGTTGGATGGCAACTCGAGTTGCCATCCAACAATACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019875.2-1496s1c1
Sequence:CCGGCCAGGTCAGTATTCTCTACTACTCGAGTAGTAGAGAATACTGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019875
ABCB9 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019875.2-595s21c1
Sequence:CCGGTCTTCGTGTGGACCTACATCTCTCGAGAGATGTAGGTCCACACGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019875.2-942s21c1
Sequence:CCGGAGCTCATTGGCCGCAGGTATTCTCGAGAATACCTGCGGCCAATGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019875.2-2793s21c1
Sequence:CCGGGCAAGCTCACTAAGATGTTTCCTCGAGGAAACATCTTAGTGAGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019875.2-2644s1c1
Sequence:CCGGCCCTTCTACTGTGTCCTTCTTCTCGAGAAGAAGGACACAGTAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019875.2-980s1c1
Sequence:CCGGCCTCGTATTTGCCAGACTGAACTCGAGTTCAGTCTGGCAAATACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019875.2-1566s1c1
Sequence:CCGGGCCTTCATCATCTACGAATTTCTCGAGAAATTCGTAGATGATGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019875.2-1910s1c1
Sequence:CCGGCCGTGTATTGTTGGATGGCAACTCGAGTTGCCATCCAACAATACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019875.2-1496s1c1
Sequence:CCGGCCAGGTCAGTATTCTCTACTACTCGAGTAGTAGAGAATACTGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019624
VALIDATED
ABCB9 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019624.3-950s21c1
Sequence:CCGGGATGGCATCGTCATCCAGAAACTCGAGTTTCTGGATGACGATGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019624.3-2845s21c1
Sequence:CCGGTCACCAAGATGTTCTAGAAACCTCGAGGTTTCTAGAACATCTTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019624.3-423s21c1
Sequence:CCGGTCCGCCACTTCAACATCTTTGCTCGAGCAAAGATGTTGAAGTGGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019624.3-1025s21c1
Sequence:CCGGAGCTCATTTGCCGCAGGTATTCTCGAGAATACCTGCGGCAAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019624.3-666s21c1
Sequence:CCGGTGTTCGTGTGGACGTACATTTCTCGAGAAATGTACGTCCACACGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019624.2-1343s1c1
Sequence:CCGGCTCTCCAAAGAGGTCCAGAATCTCGAGATTCTGGACCTCTTTGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019624.2-926s1c1
Sequence:CCGGGATGGCATCGTCATCCAGAAACTCGAGTTTCTGGATGACGATGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019624.2-1942s1c1
Sequence:CCGGCATCACGGATAACATCTCCTACTCGAGTAGGAGATGTTATCCGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019624.2-1798s1c1
Sequence:CCGGCTGTGTCAACATCCTGGAGAACTCGAGTTCTCCAGGATGTTGACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019624
VALIDATED
ABCB9 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019624.3-950s21c1
Sequence:CCGGGATGGCATCGTCATCCAGAAACTCGAGTTTCTGGATGACGATGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019624.3-2845s21c1
Sequence:CCGGTCACCAAGATGTTCTAGAAACCTCGAGGTTTCTAGAACATCTTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019624.3-423s21c1
Sequence:CCGGTCCGCCACTTCAACATCTTTGCTCGAGCAAAGATGTTGAAGTGGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019624.3-1025s21c1
Sequence:CCGGAGCTCATTTGCCGCAGGTATTCTCGAGAATACCTGCGGCAAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019624.3-666s21c1
Sequence:CCGGTGTTCGTGTGGACGTACATTTCTCGAGAAATGTACGTCCACACGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019624.2-1343s1c1
Sequence:CCGGCTCTCCAAAGAGGTCCAGAATCTCGAGATTCTGGACCTCTTTGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019624.2-926s1c1
Sequence:CCGGGATGGCATCGTCATCCAGAAACTCGAGTTTCTGGATGACGATGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019624.2-1942s1c1
Sequence:CCGGCATCACGGATAACATCTCCTACTCGAGTAGGAGATGTTATCCGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019624.2-1798s1c1
Sequence:CCGGCTGTGTCAACATCCTGGAGAACTCGAGTTCTCCAGGATGTTGACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019624
VALIDATED
ABCB9 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019624.3-950s21c1
Sequence:CCGGGATGGCATCGTCATCCAGAAACTCGAGTTTCTGGATGACGATGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019624.3-2845s21c1
Sequence:CCGGTCACCAAGATGTTCTAGAAACCTCGAGGTTTCTAGAACATCTTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019624.3-423s21c1
Sequence:CCGGTCCGCCACTTCAACATCTTTGCTCGAGCAAAGATGTTGAAGTGGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019624.3-1025s21c1
Sequence:CCGGAGCTCATTTGCCGCAGGTATTCTCGAGAATACCTGCGGCAAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019624.3-666s21c1
Sequence:CCGGTGTTCGTGTGGACGTACATTTCTCGAGAAATGTACGTCCACACGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019624.2-1343s1c1
Sequence:CCGGCTCTCCAAAGAGGTCCAGAATCTCGAGATTCTGGACCTCTTTGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019624.2-926s1c1
Sequence:CCGGGATGGCATCGTCATCCAGAAACTCGAGTTTCTGGATGACGATGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019624.2-1942s1c1
Sequence:CCGGCATCACGGATAACATCTCCTACTCGAGTAGGAGATGTTATCCGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019624.2-1798s1c1
Sequence:CCGGCTGTGTCAACATCCTGGAGAACTCGAGTTCTCCAGGATGTTGACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)