EMAIL THIS PAGE TO A FRIEND

ABCC10

ATP-binding cassette, sub-family C (CFTR/MRP), member 10

63 Gene Product Result for
Synonyms: EST182763 MRP7 SIMRP7
UniProtKB ID: Q5T3U5, Q8NHX7, Q9H7N2, Q9NXY3, Q9UF48
Gene ID:
Human(89845) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This ABC full-transporter is a member of the MRP subfamily which is involved in multi-drug resistance. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2010]
Mouse(224814) ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Rat(316231) ATP-binding cassette, subfamily C (CFTR/MRP), member 10
chicken(421456) ATP-binding cassette, sub-family C (CFTR/MRP), member 10
cow(508399) ATP-binding cassette, sub-family C (CFTR/MRP), member 10
dog(481813) ATP-binding cassette, sub-family C (CFTR/MRP), member 10
domestic cat(101087063) ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Horse(100067430) ATP-binding cassette, sub-family C (CFTR/MRP), member 10
sheep(101112932) ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Domestic Rabbit(100356200) ATP-binding cassette, sub-family C (CFTR/MRP), member 10
domestic guinea pig(100714316) ATP-binding cassette, sub-family C (CFTR/MRP), member 10
naked mole-rat(101712479) ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033450 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_170680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033450 Rosetta Predictions human pricing
NM_001108201 Rosetta Predictions rat pricing
NM_145140 Rosetta Predictions mouse pricing
NM_170680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031668 predicted 2116
2 SASI_Hs01_00031669 predicted 3686
3 SASI_Hs01_00031670 predicted 1260
4 SASI_Hs01_00031671 predicted 996
5 SASI_Hs01_00031672 predicted 1265
6 SASI_Hs01_00031673 predicted 1253
7 SASI_Hs01_00031674 predicted 2007
8 SASI_Hs01_00031675 predicted 1071
9 SASI_Hs01_00031676 predicted 1632
10 SASI_Hs01_00031677 predicted 2337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236314 predicted 3718
2 SASI_Rn02_00236315 predicted 1305
3 SASI_Rn02_00236316 predicted 2774
4 SASI_Rn02_00236317 predicted 2139
5 SASI_Rn02_00236318 predicted 1693
6 SASI_Rn02_00236319 predicted 1105
7 SASI_Rn02_00236320 predicted 3696
8 SASI_Rn02_00236321 predicted 223
9 SASI_Rn02_00236322 predicted 2976
10 SASI_Rn02_00236323 predicted 1609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138151 predicted 2518
2 SASI_Mm01_00138152 predicted 3401
3 SASI_Mm01_00138153 predicted 2800
4 SASI_Mm01_00138154 predicted 2068
5 SASI_Mm01_00138155 predicted 4978
6 SASI_Mm01_00138156 predicted 1724
7 SASI_Mm01_00138158 predicted 4313
8 SASI_Mm01_00138159 predicted 2332
9 SASI_Mm01_00138160 predicted 2096
10 SASI_Mm02_00340537 predicted 2890
11 SASI_Mm01_00138157 predicted 4362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083235 predicted 1911
2 SASI_Mm01_00083236 predicted 2800
3 SASI_Mm01_00083237 predicted 2197
4 SASI_Mm01_00083238 predicted 1467
5 SASI_Mm01_00083239 predicted 4376
6 SASI_Mm01_00083240 predicted 1123
7 SASI_Mm01_00083242 predicted 3708
8 SASI_Mm01_00083243 predicted 1730
9 SASI_Mm01_00083244 predicted 1499
10 SASI_Mm02_00343564 predicted 2284
11 SASI_Mm01_00083241 predicted 3768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033450
VALIDATED
ABCC10 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033450.2-4884s21c1
Sequence:CCGGGGCACCCTGGATTACTCTTTGCTCGAGCAAAGAGTAATCCAGGGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033450.2-1868s21c1
Sequence:CCGGGCTCATTCTTCCTCTCAACAACTCGAGTTGTTGAGAGGAAGAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033450.2-3168s21c1
Sequence:CCGGCGTTTCTACCTCACCGTGTATCTCGAGATACACGGTGAGGTAGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033450.2-1719s21c1
Sequence:CCGGCGGGTCATCAAATACCTGGATCTCGAGATCCAGGTATTTGATGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033450.2-3666s21c1
Sequence:CCGGCTGCGACTCCTTGAGCTAAACCTCGAGGTTTAGCTCAAGGAGTCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033450.2-3190s1c1
Sequence:CCGGCGACCATTGCTGGTGTAAATTCTCGAGAATTTACACCAGCAATGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033450.2-3492s1c1
Sequence:CCGGCCTTTGAGCATCATGTACTATCTCGAGATAGTACATGATGCTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033450.2-1719s1c1
Sequence:CCGGCGGGTCATCAAATACCTGGATCTCGAGATCCAGGTATTTGATGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033450.2-1868s1c1
Sequence:CCGGGCTCATTCTTCCTCTCAACAACTCGAGTTGTTGAGAGGAAGAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033450.2-3168s1c1
Sequence:CCGGCGTTTCTACCTCACCGTGTATCTCGAGATACACGGTGAGGTAGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033450
VALIDATED
ABCC10 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033450.2-4884s21c1
Sequence:CCGGGGCACCCTGGATTACTCTTTGCTCGAGCAAAGAGTAATCCAGGGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033450.2-1868s21c1
Sequence:CCGGGCTCATTCTTCCTCTCAACAACTCGAGTTGTTGAGAGGAAGAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033450.2-3168s21c1
Sequence:CCGGCGTTTCTACCTCACCGTGTATCTCGAGATACACGGTGAGGTAGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033450.2-1719s21c1
Sequence:CCGGCGGGTCATCAAATACCTGGATCTCGAGATCCAGGTATTTGATGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033450.2-3666s21c1
Sequence:CCGGCTGCGACTCCTTGAGCTAAACCTCGAGGTTTAGCTCAAGGAGTCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033450.2-3190s1c1
Sequence:CCGGCGACCATTGCTGGTGTAAATTCTCGAGAATTTACACCAGCAATGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033450.2-3492s1c1
Sequence:CCGGCCTTTGAGCATCATGTACTATCTCGAGATAGTACATGATGCTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033450.2-1719s1c1
Sequence:CCGGCGGGTCATCAAATACCTGGATCTCGAGATCCAGGTATTTGATGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033450.2-1868s1c1
Sequence:CCGGGCTCATTCTTCCTCTCAACAACTCGAGTTGTTGAGAGGAAGAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033450.2-3168s1c1
Sequence:CCGGCGTTTCTACCTCACCGTGTATCTCGAGATACACGGTGAGGTAGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033450
VALIDATED
ABCC10 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033450.2-4884s21c1
Sequence:CCGGGGCACCCTGGATTACTCTTTGCTCGAGCAAAGAGTAATCCAGGGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033450.2-1868s21c1
Sequence:CCGGGCTCATTCTTCCTCTCAACAACTCGAGTTGTTGAGAGGAAGAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033450.2-3168s21c1
Sequence:CCGGCGTTTCTACCTCACCGTGTATCTCGAGATACACGGTGAGGTAGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033450.2-1719s21c1
Sequence:CCGGCGGGTCATCAAATACCTGGATCTCGAGATCCAGGTATTTGATGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033450.2-3666s21c1
Sequence:CCGGCTGCGACTCCTTGAGCTAAACCTCGAGGTTTAGCTCAAGGAGTCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033450.2-3190s1c1
Sequence:CCGGCGACCATTGCTGGTGTAAATTCTCGAGAATTTACACCAGCAATGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033450.2-3492s1c1
Sequence:CCGGCCTTTGAGCATCATGTACTATCTCGAGATAGTACATGATGCTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033450.2-1719s1c1
Sequence:CCGGCGGGTCATCAAATACCTGGATCTCGAGATCCAGGTATTTGATGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033450.2-1868s1c1
Sequence:CCGGGCTCATTCTTCCTCTCAACAACTCGAGTTGTTGAGAGGAAGAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033450.2-3168s1c1
Sequence:CCGGCGTTTCTACCTCACCGTGTATCTCGAGATACACGGTGAGGTAGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170680
ABCC10 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-2149s1c1
Sequence:CCGGGCTCAACTATACAGGGAGGTTCTCGAGAACCTCCCTGTATAGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-1475s1c1
Sequence:CCGGGTGGCATTCGAGTCATCAAATCTCGAGATTTGATGACTCGAATGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-2980s1c1
Sequence:CCGGCACTTCTACCTCATCGTGTATCTCGAGATACACGATGAGGTAGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-2988s1c1
Sequence:CCGGCCTCATCGTGTATGCAACCATCTCGAGATGGTTGCATACACGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-4282s1c1
Sequence:CCGGGCTCTTCTTACAGATGCTAAACTCGAGTTTAGCATCTGTAAGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170680
ABCC10 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-2149s1c1
Sequence:CCGGGCTCAACTATACAGGGAGGTTCTCGAGAACCTCCCTGTATAGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-1475s1c1
Sequence:CCGGGTGGCATTCGAGTCATCAAATCTCGAGATTTGATGACTCGAATGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-2980s1c1
Sequence:CCGGCACTTCTACCTCATCGTGTATCTCGAGATACACGATGAGGTAGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-2988s1c1
Sequence:CCGGCCTCATCGTGTATGCAACCATCTCGAGATGGTTGCATACACGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-4282s1c1
Sequence:CCGGGCTCTTCTTACAGATGCTAAACTCGAGTTTAGCATCTGTAAGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170680
ABCC10 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-2149s1c1
Sequence:CCGGGCTCAACTATACAGGGAGGTTCTCGAGAACCTCCCTGTATAGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-1475s1c1
Sequence:CCGGGTGGCATTCGAGTCATCAAATCTCGAGATTTGATGACTCGAATGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-2980s1c1
Sequence:CCGGCACTTCTACCTCATCGTGTATCTCGAGATACACGATGAGGTAGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-2988s1c1
Sequence:CCGGCCTCATCGTGTATGCAACCATCTCGAGATGGTTGCATACACGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170680.1-4282s1c1
Sequence:CCGGGCTCTTCTTACAGATGCTAAACTCGAGTTTAGCATCTGTAAGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)