EMAIL THIS PAGE TO A FRIEND

ABCC11

ATP-binding cassette, sub-family C (CFTR/MRP), member 11

Synonyms: EWWD MRP8 WW
UniProtKB ID: Q96J66, Q8TDJ0, Q96JA6, Q9BX80
Gene ID:
Human(85320) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This ABC full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. The product of this gene participates in physiological processes involving bile acids, conjugated steroids, and cyclic nucleotides. In addition, a SNP in this gene is responsible for determination of human earwax type. This gene and family member ABCC12 are determined to be derived by duplication and are both localized to chromosome 16q12.1. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
sheep(101115563) ATP-binding cassette, sub-family C (CFTR/MRP), member 11
Domestic Rabbit(100359175) ATP-binding cassette, sub-family C (CFTR/MRP), member 11
dog(478138) ATP-binding cassette, sub-family C (CFTR/MRP), member 11
cow(100299784) ATP-binding cassette, sub-family C (CFTR/MRP), member 11
cow(101909197) ATP-binding cassette, sub-family C (CFTR/MRP), member 11
cow(522437) ATP-binding cassette sub-family C member 11-like
domestic cat(101089664) ATP-binding cassette, sub-family C (CFTR/MRP), member 11
Gene Class: ATPase
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032583 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065841 MISSION® esiRNA esiRNA human ABCC11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032583 Rosetta Predictions human pricing
NM_033151 Rosetta Predictions human pricing
NM_145186 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159733 predicted 1370
2 SASI_Hs02_00360115 predicted 3201
3 SASI_Hs01_00159734 predicted 793
4 SASI_Hs01_00159735 predicted 595
5 SASI_Hs01_00159736 predicted 2466
6 SASI_Hs01_00159737 predicted 979
7 SASI_Hs01_00159738 predicted 3034
8 SASI_Hs01_00159739 predicted 3364
9 SASI_Hs01_00159740 predicted 538
10 SASI_Hs01_00159741 predicted 1325
11 SASI_Hs01_00159742 predicted 2966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124247 predicted 1651
2 SASI_Hs02_00360890 predicted 3487
3 SASI_Hs01_00124248 predicted 1086
4 SASI_Hs01_00124249 predicted 888
5 SASI_Hs01_00124250 predicted 2744
6 SASI_Hs01_00124251 predicted 1266
7 SASI_Hs01_00124252 predicted 3316
8 SASI_Hs01_00124253 predicted 3652
9 SASI_Hs01_00124254 predicted 822
10 SASI_Hs01_00124255 predicted 1612
11 SASI_Hs01_00124256 predicted 3258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187885 predicted 1372
2 SASI_Hs02_00365040 predicted 3202
3 SASI_Hs01_00187886 predicted 798
4 SASI_Hs01_00187887 predicted 598
5 SASI_Hs01_00187888 predicted 2460
6 SASI_Hs01_00187889 predicted 975
7 SASI_Hs01_00187890 predicted 3035
8 SASI_Hs01_00187891 predicted 3364
9 SASI_Hs01_00187892 predicted 532
10 SASI_Hs01_00187893 predicted 1331
11 SASI_Hs01_00187894 predicted 2968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032583
ABCC11 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-873s1c1
Sequence:CCGGCGGTGATGTAAACTACCTGTTCTCGAGAACAGGTAGTTTACATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-3759s1c1
Sequence:CCGGGCTCTCAGGAACCATCAGATTCTCGAGAATCTGATGGTTCCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-1305s1c1
Sequence:CCGGGCTGAAACTCACAGCGTCAATCTCGAGATTGACGCTGTGAGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-2964s1c1
Sequence:CCGGCCTGTTAATGGGAGCCATAATCTCGAGATTATGGCTCCCATTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-1230s1c1
Sequence:CCGGCCTGACAAGTATAACCTTGTTCTCGAGAACAAGGTTATACTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032583.3-3144s21c1
Sequence:CCGGGGCTGACTGATGCGCAGAATACTCGAGTATTCTGCGCATCAGTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032583.3-1103s21c1
Sequence:CCGGACTTGCATTAAGCTGATTAAACTCGAGTTTAATCAGCTTAATGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032583
ABCC11 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-873s1c1
Sequence:CCGGCGGTGATGTAAACTACCTGTTCTCGAGAACAGGTAGTTTACATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-3759s1c1
Sequence:CCGGGCTCTCAGGAACCATCAGATTCTCGAGAATCTGATGGTTCCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-1305s1c1
Sequence:CCGGGCTGAAACTCACAGCGTCAATCTCGAGATTGACGCTGTGAGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-2964s1c1
Sequence:CCGGCCTGTTAATGGGAGCCATAATCTCGAGATTATGGCTCCCATTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-1230s1c1
Sequence:CCGGCCTGACAAGTATAACCTTGTTCTCGAGAACAAGGTTATACTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032583.3-3144s21c1
Sequence:CCGGGGCTGACTGATGCGCAGAATACTCGAGTATTCTGCGCATCAGTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032583.3-1103s21c1
Sequence:CCGGACTTGCATTAAGCTGATTAAACTCGAGTTTAATCAGCTTAATGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032583
ABCC11 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-873s1c1
Sequence:CCGGCGGTGATGTAAACTACCTGTTCTCGAGAACAGGTAGTTTACATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-3759s1c1
Sequence:CCGGGCTCTCAGGAACCATCAGATTCTCGAGAATCTGATGGTTCCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-1305s1c1
Sequence:CCGGGCTGAAACTCACAGCGTCAATCTCGAGATTGACGCTGTGAGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-2964s1c1
Sequence:CCGGCCTGTTAATGGGAGCCATAATCTCGAGATTATGGCTCCCATTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032583.2-1230s1c1
Sequence:CCGGCCTGACAAGTATAACCTTGTTCTCGAGAACAAGGTTATACTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032583.3-3144s21c1
Sequence:CCGGGGCTGACTGATGCGCAGAATACTCGAGTATTCTGCGCATCAGTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032583.3-1103s21c1
Sequence:CCGGACTTGCATTAAGCTGATTAAACTCGAGTTTAATCAGCTTAATGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks