EMAIL THIS PAGE TO A FRIEND

ABCC12

ATP-binding cassette, sub-family C (CFTR/MRP), member 12

86 Gene Product Result for
Synonyms: MRP9
UniProtKB ID: Q96J65, Q49AL2, Q8TAF0, Q8TEY2
Gene ID:
Human(94160) Summary: This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two ATP-binding domains and 12 transmembrane regions. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies: ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White. This gene is a member of the MRP subfamily which is involved in multi-drug resistance. This gene and another subfamily member are arranged head-to-tail on chromosome 16q12.1. Increased expression of this gene is associated with breast cancer. [provided by RefSeq, Jul 2008]
Mouse(244562) ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Rat(291923) ATP-binding cassette, subfamily C (CFTR/MRP), member 12
Zebrafish(568482) ATP-binding cassette, sub-family C (CFTR/MRP), member 12
cow(528068) ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Horse(100057417) ATP-binding cassette, sub-family C (CFTR/MRP), member 12
domestic cat(101089410) ATP-binding cassette, sub-family C (CFTR/MRP), member 12
dog(487294) ATP-binding cassette, sub-family C (CFTR/MRP), member 12
sheep(101115303) ATP-binding cassette, sub-family C (CFTR/MRP), member 12
naked mole-rat(101707736) ATP-binding cassette, sub-family C (CFTR/MRP), member 12
domestic guinea pig(100717367) ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033226 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033226 Rosetta Predictions human pricing
NM_199377 Rosetta Predictions rat pricing
NM_172912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361027 predicted 815
2 SASI_Hs02_00361028 predicted 3122
3 SASI_Hs01_00139403 predicted 3981
4 SASI_Hs01_00139404 predicted 2328
5 SASI_Hs01_00139407 predicted 493
6 SASI_Hs02_00361029 predicted 2050
7 SASI_Hs01_00139409 predicted 2043
8 SASI_Hs01_00139412 predicted 3922
9 SASI_Hs02_00361030 predicted 3800
10 SASI_Hs02_00361031 predicted 961
11 SASI_Hs01_00139405 predicted 977
12 SASI_Hs01_00139406 predicted 3897
13 SASI_Hs01_00139408 predicted 1632
14 SASI_Hs01_00139410 predicted 3422
15 SASI_Hs01_00139411 predicted 3835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199377 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104247 predicted 862
2 SASI_Rn01_00104248 predicted 3095
3 SASI_Rn01_00104249 predicted 1836
4 SASI_Rn01_00104250 predicted 2721
5 SASI_Rn01_00104251 predicted 2601
6 SASI_Rn01_00104252 predicted 303
7 SASI_Rn02_00270186 predicted 694
8 SASI_Rn01_00104254 predicted 2884
9 SASI_Rn01_00104255 predicted 1916
10 SASI_Rn02_00270187 predicted 1721
11 SASI_Rn01_00104253 predicted 2406
12 SASI_Rn01_00104256 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120727 predicted 499
2 SASI_Mm01_00120728 predicted 2028
3 SASI_Mm01_00120729 predicted 660
4 SASI_Mm02_00344902 predicted 2742
5 SASI_Mm01_00120730 predicted 3969
6 SASI_Mm01_00120731 predicted 3625
7 SASI_Mm01_00120732 predicted 267
8 SASI_Mm01_00120733 predicted 2893
9 SASI_Mm01_00120734 predicted 2563
10 SASI_Mm01_00120735 predicted 1564
11 SASI_Mm01_00120736 predicted 1805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033226
ABCC12 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-2467s21c1
Sequence:CCGGCAAGGATCCTGAACACCTTTACTCGAGTAAAGGTGTTCAGGATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-2687s21c1
Sequence:CCGGACATATCACACGTACATTAAGCTCGAGCTTAATGTACGTGTGATATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-2392s21c1
Sequence:CCGGGGGAACCCACAAGGAGTTAATCTCGAGATTAACTCCTTGTGGGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-994s21c1
Sequence:CCGGTGTTGGCGAGGTGCTCAATATCTCGAGATATTGAGCACCTCGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-1143s21c1
Sequence:CCGGGGATATCAGTGTATGTCATATCTCGAGATATGACATACACTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-1423s1c1
Sequence:CCGGGCTGACATTATCCTGCCACATCTCGAGATGTGGCAGGATAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-2604s1c1
Sequence:CCGGGCTCAGAATTTGTAGACACAACTCGAGTTGTGTCTACAAATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-767s1c1
Sequence:CCGGCCGGTGATTCTCATTCACCAACTCGAGTTGGTGAATGAGAATCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-3820s1c1
Sequence:CCGGCGGAAAGTCATCGTTAGGAATCTCGAGATTCCTAACGATGACTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-4394s1c1
Sequence:CCGGGCGATGTTACTAGCAGCAGAACTCGAGTTCTGCTGCTAGTAACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033226
ABCC12 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-2467s21c1
Sequence:CCGGCAAGGATCCTGAACACCTTTACTCGAGTAAAGGTGTTCAGGATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-2687s21c1
Sequence:CCGGACATATCACACGTACATTAAGCTCGAGCTTAATGTACGTGTGATATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-2392s21c1
Sequence:CCGGGGGAACCCACAAGGAGTTAATCTCGAGATTAACTCCTTGTGGGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-994s21c1
Sequence:CCGGTGTTGGCGAGGTGCTCAATATCTCGAGATATTGAGCACCTCGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-1143s21c1
Sequence:CCGGGGATATCAGTGTATGTCATATCTCGAGATATGACATACACTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-1423s1c1
Sequence:CCGGGCTGACATTATCCTGCCACATCTCGAGATGTGGCAGGATAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-2604s1c1
Sequence:CCGGGCTCAGAATTTGTAGACACAACTCGAGTTGTGTCTACAAATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-767s1c1
Sequence:CCGGCCGGTGATTCTCATTCACCAACTCGAGTTGGTGAATGAGAATCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-3820s1c1
Sequence:CCGGCGGAAAGTCATCGTTAGGAATCTCGAGATTCCTAACGATGACTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-4394s1c1
Sequence:CCGGGCGATGTTACTAGCAGCAGAACTCGAGTTCTGCTGCTAGTAACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033226
ABCC12 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-2467s21c1
Sequence:CCGGCAAGGATCCTGAACACCTTTACTCGAGTAAAGGTGTTCAGGATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-2687s21c1
Sequence:CCGGACATATCACACGTACATTAAGCTCGAGCTTAATGTACGTGTGATATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-2392s21c1
Sequence:CCGGGGGAACCCACAAGGAGTTAATCTCGAGATTAACTCCTTGTGGGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-994s21c1
Sequence:CCGGTGTTGGCGAGGTGCTCAATATCTCGAGATATTGAGCACCTCGCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033226.2-1143s21c1
Sequence:CCGGGGATATCAGTGTATGTCATATCTCGAGATATGACATACACTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-1423s1c1
Sequence:CCGGGCTGACATTATCCTGCCACATCTCGAGATGTGGCAGGATAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-2604s1c1
Sequence:CCGGGCTCAGAATTTGTAGACACAACTCGAGTTGTGTCTACAAATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-767s1c1
Sequence:CCGGCCGGTGATTCTCATTCACCAACTCGAGTTGGTGAATGAGAATCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-3820s1c1
Sequence:CCGGCGGAAAGTCATCGTTAGGAATCTCGAGATTCCTAACGATGACTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033226.1-4394s1c1
Sequence:CCGGGCGATGTTACTAGCAGCAGAACTCGAGTTCTGCTGCTAGTAACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172912
ABCC12 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172912.3-4312s1c1
Sequence:CCGGGATGGTGAAGAGTGCAGACAACTCGAGTTGTCTGCACTCTTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172912.3-689s1c1
Sequence:CCGGGCGAGGTACTAAATATACTATCTCGAGATAGTATATTTAGTACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172912.3-2899s1c1
Sequence:CCGGGCTGTAATCTTCCTCATTCTTCTCGAGAAGAATGAGGAAGATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172912.3-397s1c1
Sequence:CCGGCGAGTTCTGATGGACGTTGTACTCGAGTACAACGTCCATCAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172912.3-2164s1c1
Sequence:CCGGCCAGAGCACATTTACAATGTACTCGAGTACATTGTAAATGTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172912
ABCC12 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172912.3-4312s1c1
Sequence:CCGGGATGGTGAAGAGTGCAGACAACTCGAGTTGTCTGCACTCTTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172912.3-689s1c1
Sequence:CCGGGCGAGGTACTAAATATACTATCTCGAGATAGTATATTTAGTACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172912.3-2899s1c1
Sequence:CCGGGCTGTAATCTTCCTCATTCTTCTCGAGAAGAATGAGGAAGATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172912.3-397s1c1
Sequence:CCGGCGAGTTCTGATGGACGTTGTACTCGAGTACAACGTCCATCAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172912.3-2164s1c1
Sequence:CCGGCCAGAGCACATTTACAATGTACTCGAGTACATTGTAAATGTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172912
ABCC12 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172912.3-4312s1c1
Sequence:CCGGGATGGTGAAGAGTGCAGACAACTCGAGTTGTCTGCACTCTTCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172912.3-689s1c1
Sequence:CCGGGCGAGGTACTAAATATACTATCTCGAGATAGTATATTTAGTACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172912.3-2899s1c1
Sequence:CCGGGCTGTAATCTTCCTCATTCTTCTCGAGAAGAATGAGGAAGATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172912.3-397s1c1
Sequence:CCGGCGAGTTCTGATGGACGTTGTACTCGAGTACAACGTCCATCAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172912.3-2164s1c1
Sequence:CCGGCCAGAGCACATTTACAATGTACTCGAGTACATTGTAAATGTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks