EMAIL THIS PAGE TO A FRIEND

ABCC13

ATP-binding cassette, sub-family C (CFTR/MRP), member 13, pseudogene

87 Gene Product Result for
Synonyms: C21orf73 PRED6
UniProtKB ID: Q9NSE7, Q8N6A4, Q8N6A5
Gene ID:
chicken(418468) ATP-binding cassette, sub-family C (CFTR/MRP), member 13, pseudogene
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500551 Anti-ABCC13 antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4300936 Anti-ABCC13 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138726 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138726 Rosetta Predictions human pricing
NM_172024 Rosetta Predictions human pricing
NM_172025 Rosetta Predictions human pricing
NM_172026 Rosetta Predictions human pricing
NR_003087 Rosetta Predictions human pricing
NR_003088 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114516 predicted 424
2 SASI_Hs01_00114517 predicted 476
3 SASI_Hs01_00114518 predicted 413
4 SASI_Hs01_00114519 predicted 440
5 SASI_Hs01_00114520 predicted 414
6 SASI_Hs01_00114521 predicted 408
7 SASI_Hs01_00114522 predicted 452
8 SASI_Hs01_00114523 predicted 416
9 SASI_Hs01_00114524 predicted 322
10 SASI_Hs01_00114525 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055890 predicted 699
2 SASI_Hs01_00055891 predicted 639
3 SASI_Hs01_00055892 predicted 756
4 SASI_Hs01_00055893 predicted 707
5 SASI_Hs01_00055894 predicted 754
6 SASI_Hs01_00055895 predicted 772
7 SASI_Hs01_00055896 predicted 695
8 SASI_Hs01_00055897 predicted 865
9 SASI_Hs01_00055898 predicted 644
10 SASI_Hs01_00055899 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115819 predicted 426
2 SASI_Hs01_00115820 predicted 476
3 SASI_Hs01_00115821 predicted 411
4 SASI_Hs01_00115822 predicted 436
5 SASI_Hs01_00115823 predicted 405
6 SASI_Hs01_00115824 predicted 414
7 SASI_Hs01_00115825 predicted 451
8 SASI_Hs01_00115826 predicted 416
9 SASI_Hs01_00115827 predicted 317
10 SASI_Hs01_00115828 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151512 predicted 609
2 SASI_Hs01_00151513 predicted 562
3 SASI_Hs01_00151514 predicted 663
4 SASI_Hs01_00151515 predicted 615
5 SASI_Hs01_00151516 predicted 659
6 SASI_Hs01_00151517 predicted 688
7 SASI_Hs01_00151518 predicted 615
8 SASI_Hs01_00151519 predicted 782
9 SASI_Hs01_00151520 predicted 559
10 SASI_Hs01_00151521 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378126 predicted 1929
2 SASI_Hs02_00378127 predicted 609
3 SASI_Hs02_00378128 predicted 2027
4 SASI_Hs02_00378129 predicted 635
5 SASI_Hs02_00378130 predicted 431
6 SASI_Hs02_00378131 predicted 597
7 SASI_Hs02_00378132 predicted 400
8 SASI_Hs02_00378133 predicted 970
9 SASI_Hs02_00378134 predicted 856
10 SASI_Hs02_00378135 predicted 2072
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378136 predicted 417
2 SASI_Hs02_00378137 predicted 284
3 SASI_Hs02_00378138 predicted 402
4 SASI_Hs02_00378139 predicted 428
5 SASI_Hs02_00378140 predicted 221
6 SASI_Hs02_00378141 predicted 404
7 SASI_Hs02_00378142 predicted 575
8 SASI_Hs02_00378143 predicted 491
9 SASI_Hs02_00378144 predicted 311
10 SASI_Hs02_00378145 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138726
ABCC13 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 13, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-436s1c1
Sequence:CCGGGCTATAAGAGACCTTTGGAAACTCGAGTTTCCAAAGGTCTCTTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-644s1c1
Sequence:CCGGCCTGATTCAAGTTGCCTTATTCTCGAGAATAAGGCAACTTGAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-346s1c1
Sequence:CCGGCGCTTGATACACAGAAATGCACTCGAGTGCATTTCTGTGTATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-409s1c1
Sequence:CCGGCCTGGTTTAGCAGAGTAATTACTCGAGTAATTACTCTGCTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-574s1c1
Sequence:CCGGCTTGTTATAAAGAGGCACATACTCGAGTATGTGCCTCTTTATAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138726
ABCC13 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 13, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-436s1c1
Sequence:CCGGGCTATAAGAGACCTTTGGAAACTCGAGTTTCCAAAGGTCTCTTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-644s1c1
Sequence:CCGGCCTGATTCAAGTTGCCTTATTCTCGAGAATAAGGCAACTTGAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-346s1c1
Sequence:CCGGCGCTTGATACACAGAAATGCACTCGAGTGCATTTCTGTGTATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-409s1c1
Sequence:CCGGCCTGGTTTAGCAGAGTAATTACTCGAGTAATTACTCTGCTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-574s1c1
Sequence:CCGGCTTGTTATAAAGAGGCACATACTCGAGTATGTGCCTCTTTATAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138726
ABCC13 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 13, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-436s1c1
Sequence:CCGGGCTATAAGAGACCTTTGGAAACTCGAGTTTCCAAAGGTCTCTTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-644s1c1
Sequence:CCGGCCTGATTCAAGTTGCCTTATTCTCGAGAATAAGGCAACTTGAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-346s1c1
Sequence:CCGGCGCTTGATACACAGAAATGCACTCGAGTGCATTTCTGTGTATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-409s1c1
Sequence:CCGGCCTGGTTTAGCAGAGTAATTACTCGAGTAATTACTCTGCTAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138726.2-574s1c1
Sequence:CCGGCTTGTTATAAAGAGGCACATACTCGAGTATGTGCCTCTTTATAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks