EMAIL THIS PAGE TO A FRIEND

ABCC1

ATP-binding cassette, sub-family C (CFTR/MRP), member 1

157 Gene Product Result for
Synonyms: ABC29 ABCC GS-X MRP MRP1
Gene ID:
Human(4363) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra-and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a multispecific organic anion transporter, with oxidized glutatione, cysteinyl leukotrienes, and activated aflatoxin B1 as substrates. This protein also transports glucuronides and sulfate conjugates of steroid hormones and bile salts. Alternatively spliced variants of this gene have been described but their full-length nature is unknown. [provided by RefSeq, Apr 2012]
Mouse(17250) ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Rat(24565) ATP-binding cassette, subfamily C (CFTR/MRP), member 1
naked mole-rat(101725452) ATP-binding cassette, sub-family C (CFTR/MRP), member 1
domestic guinea pig(100734674) ATP-binding cassette, sub-family C (CFTR/MRP), member 1
sheep(101110991) ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Domestic Rabbit(100345841) ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Zebrafish(100002010) ATP-binding cassette, sub-family C, member 1
chicken(395416) ATP-binding cassette, sub-family C (CFTR/MRP), member 1
cow(281588) ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Horse(791240) ATP-binding cassette, sub-family C (CFTR/MRP), member 1
dog(403453) ATP-binding cassette, sub-family C (CFTR/MRP), member 1
domestic cat(101101279) ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500010 Anti-ABCC1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, bovine, mouse, canine
ELISA, western blot pricing
HPA002380 Anti-ABCC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunofluorescence, immunohistochemistry pricing
SAB2100010 Anti-ABCC1 antibody produced in rabbit affinity isolated antibody canine, human, bovine, guinea pig, rabbit, horse
western blot pricing
M9067 Monoclonal Anti-MRP1 antibody produced in mouse ~2 mg/mL, clone QCRL-1, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
M9192 Monoclonal Anti-MRP1 antibody produced in mouse ~2 mg/mL, clone QCRL-4, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004996 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004996 siRNAs that have been validated in the lab human pricing
NM_019862 Rosetta Predictions human pricing
NM_019898 Rosetta Predictions human pricing
NM_019899 Rosetta Predictions human pricing
NM_019900 Rosetta Predictions human pricing
NM_019901 Rosetta Predictions human pricing
NM_019902 Rosetta Predictions human pricing
NM_022281 Rosetta Predictions rat pricing
XM_001053148 Rosetta Predictions rat pricing
NM_008576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004996 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155530 validated 3883
1 SASI_Hs01_00155531 validated 1554
1 SASI_Hs01_00155529 validated 1035
2 SASI_Hs02_00338729 predicted 682
3 SASI_Hs01_00155534 predicted 1621
4 SASI_Hs01_00155535 predicted 362
5 SASI_Hs01_00155537 predicted 3938
6 SASI_Hs02_00338730 predicted 586
7 SASI_Hs02_00338731 predicted 1668
8 SASI_Hs02_00338732 predicted 2020
9 SASI_Hs02_00338733 predicted 766
10 SASI_Hs01_00155532 predicted 2865
11 SASI_Hs01_00155533 predicted 3949
12 SASI_Hs01_00155536 predicted 396
13 SASI_Hs01_00155538 predicted 1406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172886 predicted 1036
2 SASI_Hs01_00172887 predicted 3704
3 SASI_Hs02_00352889 predicted 688
4 SASI_Hs01_00172891 predicted 1616
5 SASI_Hs01_00172892 predicted 370
6 SASI_Hs01_00172894 predicted 3762
7 SASI_Hs02_00352890 predicted 587
8 SASI_Hs02_00352891 predicted 1660
9 SASI_Hs02_00352892 predicted 2021
10 SASI_Hs02_00352893 predicted 764
11 SASI_Hs01_00172888 predicted 1554
12 SASI_Hs01_00172889 predicted 2697
13 SASI_Hs01_00172890 predicted 3770
14 SASI_Hs01_00172893 predicted 390
15 SASI_Hs01_00172895 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118876 predicted 1029
2 SASI_Hs01_00118877 predicted 3713
3 SASI_Hs02_00352926 predicted 681
4 SASI_Hs01_00118881 predicted 1617
5 SASI_Hs01_00118882 predicted 361
6 SASI_Hs01_00118884 predicted 3769
7 SASI_Hs02_00352927 predicted 588
8 SASI_Hs02_00352928 predicted 1665
9 SASI_Hs02_00352929 predicted 2015
10 SASI_Hs02_00352930 predicted 771
11 SASI_Hs01_00118878 predicted 1559
12 SASI_Hs01_00118879 predicted 2697
13 SASI_Hs01_00118880 predicted 3782
14 SASI_Hs01_00118883 predicted 397
15 SASI_Hs01_00118885 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177639 predicted 1030
2 SASI_Hs01_00177640 predicted 3538
3 SASI_Hs02_00352931 predicted 679
4 SASI_Hs01_00177644 predicted 1621
5 SASI_Hs01_00177645 predicted 369
6 SASI_Hs01_00177647 predicted 3596
7 SASI_Hs02_00352932 predicted 587
8 SASI_Hs02_00352933 predicted 1663
9 SASI_Hs02_00352934 predicted 2023
10 SASI_Hs02_00352935 predicted 771
11 SASI_Hs01_00177641 predicted 1555
12 SASI_Hs01_00177642 predicted 2520
13 SASI_Hs01_00177643 predicted 3599
14 SASI_Hs01_00177646 predicted 396
15 SASI_Hs01_00177648 predicted 1398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220942 predicted 1031
2 SASI_Hs01_00220943 predicted 3878
3 SASI_Hs02_00352936 predicted 684
4 SASI_Hs01_00220947 predicted 1617
5 SASI_Hs01_00220948 predicted 367
6 SASI_Hs01_00220950 predicted 3937
7 SASI_Hs02_00352937 predicted 587
8 SASI_Hs02_00352938 predicted 1666
9 SASI_Hs02_00352939 predicted 2024
10 SASI_Hs02_00352940 predicted 769
11 SASI_Hs01_00220944 predicted 1560
12 SASI_Hs01_00220945 predicted 2869
13 SASI_Hs01_00220946 predicted 3944
14 SASI_Hs01_00220949 predicted 390
15 SASI_Hs01_00220951 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161245 predicted 938
2 SASI_Hs01_00161246 predicted 3776
3 SASI_Hs01_00161247 predicted 1434
4 SASI_Hs01_00161248 predicted 2740
5 SASI_Hs01_00161249 predicted 3818
6 SASI_Hs01_00161250 predicted 1525
7 SASI_Hs01_00161251 predicted 387
8 SASI_Hs01_00161252 predicted 391
9 SASI_Hs01_00161253 predicted 3832
10 SASI_Hs01_00161254 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061965 predicted 1054
2 SASI_Hs01_00061966 predicted 3755
3 SASI_Hs01_00061967 predicted 1556
4 SASI_Hs01_00061968 predicted 2720
5 SASI_Hs01_00061969 predicted 3796
6 SASI_Hs01_00061970 predicted 1652
7 SASI_Hs01_00061971 predicted 397
8 SASI_Hs01_00061972 predicted 392
9 SASI_Hs01_00061973 predicted 3820
10 SASI_Hs01_00061974 predicted 1398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022281 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036020 predicted 4186
2 SASI_Rn01_00036022 predicted 1006
3 SASI_Rn01_00036023 predicted 546
4 SASI_Rn01_00036024 predicted 3011
5 SASI_Rn01_00036025 predicted 3122
6 SASI_Rn01_00036026 predicted 973
7 SASI_Rn02_00263092 predicted 2248
8 SASI_Rn02_00263093 predicted 1483
9 SASI_Rn01_00036027 predicted 3782
10 SASI_Rn02_00263094 predicted 1724
11 SASI_Rn01_00036021 predicted 2628
12 SASI_Rn01_00036028 predicted 2926
13 SASI_Rn01_00036029 predicted 3299
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271413 predicted 3947
2 SASI_Rn02_00271414 predicted 1086
3 SASI_Rn02_00271415 predicted 2018
4 SASI_Rn02_00271416 predicted 2767
5 SASI_Rn02_00271417 predicted 2873
6 SASI_Rn02_00271418 predicted 1058
7 SASI_Rn02_00271419 predicted 2252
8 SASI_Rn02_00271420 predicted 1568
9 SASI_Rn02_00271421 predicted 3537
10 SASI_Rn02_00271422 predicted 1803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314196 predicted 3899
2 SASI_Mm01_00102274 predicted 964
3 SASI_Mm01_00102275 predicted 685
4 SASI_Mm01_00102276 predicted 1916
5 SASI_Mm02_00314197 predicted 541
6 SASI_Mm01_00102278 predicted 4466
7 SASI_Mm01_00102279 predicted 441
8 SASI_Mm01_00102280 predicted 2898
9 SASI_Mm01_00102281 predicted 425
10 SASI_Mm01_00102282 predicted 1443
11 SASI_Mm01_00102277 predicted 1071
12 SASI_Mm01_00102283 predicted 3420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004996
VALIDATED
ABCC1 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004996.2-1128s1c1
Sequence:CCGGCCTCTCTGTTTAAGGTGTTATCTCGAGATAACACCTTAAACAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004996.2-3889s1c1
Sequence:CCGGCCTCTCAGTGTCTTACTCATTCTCGAGAATGAGTAAGACACTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004996.2-2552s1c1
Sequence:CCGGGCTGACATTTACCTCTTCGATCTCGAGATCGAAGAGGTAAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004996.2-1675s1c1
Sequence:CCGGCCACATGAAGAGCAAAGACAACTCGAGTTGTCTTTGCTCTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004996.2-4207s1c1
Sequence:CCGGCCTGGGCTTATTTCGGATCAACTCGAGTTGATCCGAAATAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-4186s21c1
Sequence:CCGGCCTGGGCTTATTTCGGATCAACTCGAGTTGATCCGAAATAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-5241s21c1
Sequence:CCGGTCTACCAGGAACGCTTCATTTCTCGAGAAATGAAGCGTTCCTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-2531s21c1
Sequence:CCGGGCTGACATTTACCTCTTCGATCTCGAGATCGAAGAGGTAAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-1654s21c1
Sequence:CCGGCCACATGAAGAGCAAAGACAACTCGAGTTGTCTTTGCTCTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-3868s21c1
Sequence:CCGGCCTCTCAGTGTCTTACTCATTCTCGAGAATGAGTAAGACACTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004996
VALIDATED
ABCC1 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004996.2-1128s1c1
Sequence:CCGGCCTCTCTGTTTAAGGTGTTATCTCGAGATAACACCTTAAACAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004996.2-3889s1c1
Sequence:CCGGCCTCTCAGTGTCTTACTCATTCTCGAGAATGAGTAAGACACTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004996.2-2552s1c1
Sequence:CCGGGCTGACATTTACCTCTTCGATCTCGAGATCGAAGAGGTAAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004996.2-1675s1c1
Sequence:CCGGCCACATGAAGAGCAAAGACAACTCGAGTTGTCTTTGCTCTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004996.2-4207s1c1
Sequence:CCGGCCTGGGCTTATTTCGGATCAACTCGAGTTGATCCGAAATAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-4186s21c1
Sequence:CCGGCCTGGGCTTATTTCGGATCAACTCGAGTTGATCCGAAATAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-5241s21c1
Sequence:CCGGTCTACCAGGAACGCTTCATTTCTCGAGAAATGAAGCGTTCCTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-2531s21c1
Sequence:CCGGGCTGACATTTACCTCTTCGATCTCGAGATCGAAGAGGTAAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-1654s21c1
Sequence:CCGGCCACATGAAGAGCAAAGACAACTCGAGTTGTCTTTGCTCTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-3868s21c1
Sequence:CCGGCCTCTCAGTGTCTTACTCATTCTCGAGAATGAGTAAGACACTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004996
VALIDATED
ABCC1 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004996.2-1128s1c1
Sequence:CCGGCCTCTCTGTTTAAGGTGTTATCTCGAGATAACACCTTAAACAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004996.2-3889s1c1
Sequence:CCGGCCTCTCAGTGTCTTACTCATTCTCGAGAATGAGTAAGACACTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004996.2-2552s1c1
Sequence:CCGGGCTGACATTTACCTCTTCGATCTCGAGATCGAAGAGGTAAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004996.2-1675s1c1
Sequence:CCGGCCACATGAAGAGCAAAGACAACTCGAGTTGTCTTTGCTCTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004996.2-4207s1c1
Sequence:CCGGCCTGGGCTTATTTCGGATCAACTCGAGTTGATCCGAAATAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-4186s21c1
Sequence:CCGGCCTGGGCTTATTTCGGATCAACTCGAGTTGATCCGAAATAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-5241s21c1
Sequence:CCGGTCTACCAGGAACGCTTCATTTCTCGAGAAATGAAGCGTTCCTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-2531s21c1
Sequence:CCGGGCTGACATTTACCTCTTCGATCTCGAGATCGAAGAGGTAAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-1654s21c1
Sequence:CCGGCCACATGAAGAGCAAAGACAACTCGAGTTGTCTTTGCTCTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004996.3-3868s21c1
Sequence:CCGGCCTCTCAGTGTCTTACTCATTCTCGAGAATGAGTAAGACACTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008576
VALIDATED
ABCC1 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008576.2-5428s1c1
Sequence:CCGGCGGGCAAGAATCTGGTATCAACTCGAGTTGATACCAGATTCTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008576.2-437s1c1
Sequence:CCGGCCTCGGGAATTATGCTTACTTCTCGAGAAGTAAGCATAATTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008576.2-4195s1c1
Sequence:CCGGCCTTTCAGTCAGTATTCTGATCTCGAGATCAGAATACTGACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008576.2-115s1c1
Sequence:CCGGCCCGACTTTACCAAGTGCTTTCTCGAGAAAGCACTTGGTAAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008576.2-1299s1c1
Sequence:CCGGCGGAGAGATTGTCAACCTCATCTCGAGATGAGGTTGACAATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-3900s21c1
Sequence:CCGGCCGTGTAGAGTTCCGGGATTACTCGAGTAATCCCGGAACTCTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-5373s21c1
Sequence:CCGGAGGTCTATGAATAGTTATAAGCTCGAGCTTATAACTATTCATAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-4483s21c1
Sequence:CCGGCATCGGCTTAACACCATAATGCTCGAGCATTATGGTGTTAAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-1343s21c1
Sequence:CCGGTGGACTTGGCCACGTACATTACTCGAGTAATGTACGTGGCCAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-429s21c1
Sequence:CCGGAGTCCAATCCTCGGGAATTATCTCGAGATAATTCCCGAGGATTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008576
VALIDATED
ABCC1 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008576.2-5428s1c1
Sequence:CCGGCGGGCAAGAATCTGGTATCAACTCGAGTTGATACCAGATTCTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008576.2-437s1c1
Sequence:CCGGCCTCGGGAATTATGCTTACTTCTCGAGAAGTAAGCATAATTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008576.2-4195s1c1
Sequence:CCGGCCTTTCAGTCAGTATTCTGATCTCGAGATCAGAATACTGACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008576.2-115s1c1
Sequence:CCGGCCCGACTTTACCAAGTGCTTTCTCGAGAAAGCACTTGGTAAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008576.2-1299s1c1
Sequence:CCGGCGGAGAGATTGTCAACCTCATCTCGAGATGAGGTTGACAATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-3900s21c1
Sequence:CCGGCCGTGTAGAGTTCCGGGATTACTCGAGTAATCCCGGAACTCTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-5373s21c1
Sequence:CCGGAGGTCTATGAATAGTTATAAGCTCGAGCTTATAACTATTCATAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-4483s21c1
Sequence:CCGGCATCGGCTTAACACCATAATGCTCGAGCATTATGGTGTTAAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-1343s21c1
Sequence:CCGGTGGACTTGGCCACGTACATTACTCGAGTAATGTACGTGGCCAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-429s21c1
Sequence:CCGGAGTCCAATCCTCGGGAATTATCTCGAGATAATTCCCGAGGATTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008576
VALIDATED
ABCC1 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008576.2-5428s1c1
Sequence:CCGGCGGGCAAGAATCTGGTATCAACTCGAGTTGATACCAGATTCTTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008576.2-437s1c1
Sequence:CCGGCCTCGGGAATTATGCTTACTTCTCGAGAAGTAAGCATAATTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008576.2-4195s1c1
Sequence:CCGGCCTTTCAGTCAGTATTCTGATCTCGAGATCAGAATACTGACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008576.2-115s1c1
Sequence:CCGGCCCGACTTTACCAAGTGCTTTCTCGAGAAAGCACTTGGTAAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008576.2-1299s1c1
Sequence:CCGGCGGAGAGATTGTCAACCTCATCTCGAGATGAGGTTGACAATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-3900s21c1
Sequence:CCGGCCGTGTAGAGTTCCGGGATTACTCGAGTAATCCCGGAACTCTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-5373s21c1
Sequence:CCGGAGGTCTATGAATAGTTATAAGCTCGAGCTTATAACTATTCATAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-4483s21c1
Sequence:CCGGCATCGGCTTAACACCATAATGCTCGAGCATTATGGTGTTAAGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-1343s21c1
Sequence:CCGGTGGACTTGGCCACGTACATTACTCGAGTAATGTACGTGGCCAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008576.2-429s21c1
Sequence:CCGGAGTCCAATCCTCGGGAATTATCTCGAGATAATTCCCGAGGATTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks