EMAIL THIS PAGE TO A FRIEND

ABCC2

ATP-binding cassette, sub-family C (CFTR/MRP), member 2

75 Gene Product Result for
Synonyms: ABC30 CMOAT DJS MRP2 cMRP
Gene ID:
Human(1244) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein is expressed in the canalicular (apical) part of the hepatocyte and functions in biliary transport. Substrates include anticancer drugs such as vinblastine; therefore, this protein appears to contribute to drug resistance in mammalian cells. Several different mutations in this gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. [provided by RefSeq, Jul 2008]
Mouse(12780) ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Rat(25303) ATP-binding cassette, subfamily C (CFTR/MRP), member 2
Zebrafish(393561) ATP-binding cassette, sub-family C (CFTR/MRP), member 2
chicken(423828) ATP-binding cassette, sub-family C (CFTR/MRP), member 2
domestic cat(101085924) ATP-binding cassette, sub-family C (CFTR/MRP), member 2
cow(520925) ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Horse(100060654) ATP-binding cassette, sub-family C (CFTR/MRP), member 2
dog(403632) ATP-binding cassette, sub-family C (CFTR/MRP), member 2
domestic guinea pig(100718828) ATP-binding cassette, sub-family C (CFTR/MRP), member 2
naked mole-rat(101716089) ATP-binding cassette, sub-family C (CFTR/MRP), member 2
sheep(101119776) ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK161 Multidrug Resistance Assay Kit (Fluorometric MDR Assay) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000392 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052041 MISSION® esiRNA esiRNA human ABCC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000392 Rosetta Predictions human pricing
NM_012833 Rosetta Predictions rat pricing
XM_577883 Rosetta Predictions rat pricing
NM_013806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056180 predicted 1582
2 SASI_Hs01_00056181 predicted 2065
3 SASI_Hs01_00056182 predicted 3033
4 SASI_Hs01_00056184 predicted 1475
5 SASI_Hs01_00056185 predicted 1614
6 SASI_Hs01_00056186 predicted 3381
7 SASI_Hs01_00056187 predicted 1768
8 SASI_Hs01_00056188 predicted 3220
9 SASI_Hs02_00302464 predicted 3389
10 SASI_Hs01_00056189 predicted 2845
11 SASI_Hs01_00056183 predicted 3411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012833 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260299 predicted 4613
2 SASI_Rn01_00104075 predicted 3872
3 SASI_Rn02_00260300 predicted 1517
4 SASI_Rn01_00104077 predicted 996
5 SASI_Rn01_00104078 predicted 3166
6 SASI_Rn02_00260301 predicted 3547
7 SASI_Rn01_00104079 predicted 1923
8 SASI_Rn01_00104080 predicted 771
9 SASI_Rn01_00104081 predicted 2971
10 SASI_Rn01_00104083 predicted 4581
11 SASI_Rn01_00104076 predicted 3189
12 SASI_Rn01_00104082 predicted 1779
13 SASI_Rn01_00104084 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407228 predicted 1313
2 SASI_Rn02_00407229 predicted 573
3 SASI_Rn02_00407230 predicted 1449
4 SASI_Rn02_00407231 predicted 1371
5 SASI_Rn02_00407232 predicted 673
6 SASI_Rn02_00407233 predicted 512
7 SASI_Rn02_00407234 predicted 1274
8 SASI_Rn02_00407235 predicted 582
9 SASI_Rn02_00407236 predicted 1439
10 SASI_Rn02_00407237 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196217 predicted 1152
2 SASI_Mm01_00196218 predicted 684
3 SASI_Mm01_00196219 predicted 1073
4 SASI_Mm01_00196220 predicted 4655
5 SASI_Mm01_00196221 predicted 1562
6 SASI_Mm02_00322766 predicted 1292
7 SASI_Mm01_00196222 predicted 3174
8 SASI_Mm01_00196223 predicted 2981
9 SASI_Mm01_00196226 predicted 294
10 SASI_Mm02_00322767 predicted 521
11 SASI_Mm01_00196224 predicted 2804
12 SASI_Mm01_00196225 predicted 4495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000392
VALIDATED
ABCC2 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000392.1-187s1c1
Sequence:CCGGCGTGTATAAATCCAGGACCAACTCGAGTTGGTCCTGGATTTATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000392.1-1735s1c1
Sequence:CCGGCCTGGTGGATAGCAACAATATCTCGAGATATTGTTGCTATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000392.1-2803s1c1
Sequence:CCGGGCATCTGAAGTCCCTGAGAAACTCGAGTTTCTCAGGGACTTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000392.1-4097s1c1
Sequence:CCGGGCCGGTGGTCAGATTATCATTCTCGAGAATGATAATCTGACCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000392.1-624s1c1
Sequence:CCGGCCATAGCTTCATTCCTGAGTACTCGAGTACTCAGGAATGAAGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000392.3-1550s21c1
Sequence:CCGGGTGCTTGTAATCCCAATTAATCTCGAGATTAATTGGGATTACAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_000392.3-2905s21c1
Sequence:CCGGGCATCTGAAGTCCCTGAGAAACTCGAGTTTCTCAGGGACTTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_000392.3-726s21c1
Sequence:CCGGCCATAGCTTCATTCCTGAGTACTCGAGTACTCAGGAATGAAGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000392.3-1837s21c1
Sequence:CCGGCCTGGTGGATAGCAACAATATCTCGAGATATTGTTGCTATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000392.3-4199s21c1
Sequence:CCGGGCCGGTGGTCAGATTATCATTCTCGAGAATGATAATCTGACCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000392
VALIDATED
ABCC2 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000392.1-187s1c1
Sequence:CCGGCGTGTATAAATCCAGGACCAACTCGAGTTGGTCCTGGATTTATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000392.1-1735s1c1
Sequence:CCGGCCTGGTGGATAGCAACAATATCTCGAGATATTGTTGCTATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000392.1-2803s1c1
Sequence:CCGGGCATCTGAAGTCCCTGAGAAACTCGAGTTTCTCAGGGACTTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000392.1-4097s1c1
Sequence:CCGGGCCGGTGGTCAGATTATCATTCTCGAGAATGATAATCTGACCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000392.1-624s1c1
Sequence:CCGGCCATAGCTTCATTCCTGAGTACTCGAGTACTCAGGAATGAAGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000392.3-1550s21c1
Sequence:CCGGGTGCTTGTAATCCCAATTAATCTCGAGATTAATTGGGATTACAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_000392.3-2905s21c1
Sequence:CCGGGCATCTGAAGTCCCTGAGAAACTCGAGTTTCTCAGGGACTTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_000392.3-726s21c1
Sequence:CCGGCCATAGCTTCATTCCTGAGTACTCGAGTACTCAGGAATGAAGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000392.3-1837s21c1
Sequence:CCGGCCTGGTGGATAGCAACAATATCTCGAGATATTGTTGCTATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000392.3-4199s21c1
Sequence:CCGGGCCGGTGGTCAGATTATCATTCTCGAGAATGATAATCTGACCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000392
VALIDATED
ABCC2 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000392.1-187s1c1
Sequence:CCGGCGTGTATAAATCCAGGACCAACTCGAGTTGGTCCTGGATTTATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000392.1-1735s1c1
Sequence:CCGGCCTGGTGGATAGCAACAATATCTCGAGATATTGTTGCTATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000392.1-2803s1c1
Sequence:CCGGGCATCTGAAGTCCCTGAGAAACTCGAGTTTCTCAGGGACTTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000392.1-4097s1c1
Sequence:CCGGGCCGGTGGTCAGATTATCATTCTCGAGAATGATAATCTGACCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000392.1-624s1c1
Sequence:CCGGCCATAGCTTCATTCCTGAGTACTCGAGTACTCAGGAATGAAGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000392.3-1550s21c1
Sequence:CCGGGTGCTTGTAATCCCAATTAATCTCGAGATTAATTGGGATTACAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_000392.3-2905s21c1
Sequence:CCGGGCATCTGAAGTCCCTGAGAAACTCGAGTTTCTCAGGGACTTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_000392.3-726s21c1
Sequence:CCGGCCATAGCTTCATTCCTGAGTACTCGAGTACTCAGGAATGAAGCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000392.3-1837s21c1
Sequence:CCGGCCTGGTGGATAGCAACAATATCTCGAGATATTGTTGCTATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000392.3-4199s21c1
Sequence:CCGGGCCGGTGGTCAGATTATCATTCTCGAGAATGATAATCTGACCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013806
VALIDATED
ABCC2 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013806.1-576s1c1
Sequence:CCGGCCCATCAGCTACAGCTTCATTCTCGAGAATGAAGCTGTAGCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013806.1-2504s1c1
Sequence:CCGGGCACCATCTTAGAGAAGGGATCTCGAGATCCCTTCTCTAAGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013806.1-130s1c1
Sequence:CCGGCCTTGGCAACTTTACAGAATACTCGAGTATTCTGTAAAGTTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013806.1-3659s1c1
Sequence:CCGGCGGCCTTGCTTCTGGTTATTTCTCGAGAAATAACCAGAAGCAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013806.1-4963s1c1
Sequence:CCGGCGGGCATAGTTGTCCATGATACTCGAGTATCATGGACAACTATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013806.2-672s21c1
Sequence:CCGGCCCATCAGCTACAGCTTCATTCTCGAGAATGAAGCTGTAGCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013806.2-3755s21c1
Sequence:CCGGCGGCCTTGCTTCTGGTTATTTCTCGAGAAATAACCAGAAGCAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013806.2-226s21c1
Sequence:CCGGCCTTGGCAACTTTACAGAATACTCGAGTATTCTGTAAAGTTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013806.2-4999s21c1
Sequence:CCGGGAAAGCGTGAGGGTCCGATTTCTCGAGAAATCGGACCCTCACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013806.2-2350s21c1
Sequence:CCGGATCGGAGAGAAGGGTATAAATCTCGAGATTTATACCCTTCTCTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013806
VALIDATED
ABCC2 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013806.1-576s1c1
Sequence:CCGGCCCATCAGCTACAGCTTCATTCTCGAGAATGAAGCTGTAGCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013806.1-2504s1c1
Sequence:CCGGGCACCATCTTAGAGAAGGGATCTCGAGATCCCTTCTCTAAGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013806.1-130s1c1
Sequence:CCGGCCTTGGCAACTTTACAGAATACTCGAGTATTCTGTAAAGTTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013806.1-3659s1c1
Sequence:CCGGCGGCCTTGCTTCTGGTTATTTCTCGAGAAATAACCAGAAGCAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013806.1-4963s1c1
Sequence:CCGGCGGGCATAGTTGTCCATGATACTCGAGTATCATGGACAACTATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013806.2-672s21c1
Sequence:CCGGCCCATCAGCTACAGCTTCATTCTCGAGAATGAAGCTGTAGCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013806.2-3755s21c1
Sequence:CCGGCGGCCTTGCTTCTGGTTATTTCTCGAGAAATAACCAGAAGCAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013806.2-226s21c1
Sequence:CCGGCCTTGGCAACTTTACAGAATACTCGAGTATTCTGTAAAGTTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013806.2-4999s21c1
Sequence:CCGGGAAAGCGTGAGGGTCCGATTTCTCGAGAAATCGGACCCTCACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013806.2-2350s21c1
Sequence:CCGGATCGGAGAGAAGGGTATAAATCTCGAGATTTATACCCTTCTCTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013806
VALIDATED
ABCC2 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013806.1-576s1c1
Sequence:CCGGCCCATCAGCTACAGCTTCATTCTCGAGAATGAAGCTGTAGCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013806.1-2504s1c1
Sequence:CCGGGCACCATCTTAGAGAAGGGATCTCGAGATCCCTTCTCTAAGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013806.1-130s1c1
Sequence:CCGGCCTTGGCAACTTTACAGAATACTCGAGTATTCTGTAAAGTTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013806.1-3659s1c1
Sequence:CCGGCGGCCTTGCTTCTGGTTATTTCTCGAGAAATAACCAGAAGCAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013806.1-4963s1c1
Sequence:CCGGCGGGCATAGTTGTCCATGATACTCGAGTATCATGGACAACTATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013806.2-672s21c1
Sequence:CCGGCCCATCAGCTACAGCTTCATTCTCGAGAATGAAGCTGTAGCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013806.2-3755s21c1
Sequence:CCGGCGGCCTTGCTTCTGGTTATTTCTCGAGAAATAACCAGAAGCAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013806.2-226s21c1
Sequence:CCGGCCTTGGCAACTTTACAGAATACTCGAGTATTCTGTAAAGTTGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013806.2-4999s21c1
Sequence:CCGGGAAAGCGTGAGGGTCCGATTTCTCGAGAAATCGGACCCTCACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013806.2-2350s21c1
Sequence:CCGGATCGGAGAGAAGGGTATAAATCTCGAGATTTATACCCTTCTCTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks