EMAIL THIS PAGE TO A FRIEND

ABCC3

ATP-binding cassette, sub-family C (CFTR/MRP), member 3

55 Gene Product Result for
Synonyms: ABC31 EST90757 MLP2 MOAT-D MRP3 cMOAT2
Gene ID:
Human(8714) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in the transport of biliary and intestinal excretion of organic anions. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Mouse(76408) ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Rat(140668) ATP-binding cassette, subfamily C (CFTR/MRP), member 3
sheep(101116746) ATP-binding cassette, sub-family C (CFTR/MRP), member 3
naked mole-rat(101717930) ATP-binding cassette, sub-family C (CFTR/MRP), member 3
domestic guinea pig(100713825) ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Zebrafish(323301) ATP-binding cassette, sub-family C (CFTR/MRP), member 3
cow(533151) ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Horse(100070025) ATP-binding cassette, sub-family C (CFTR/MRP), member 3
domestic cat(101098502) ATP-binding cassette, sub-family C (CFTR/MRP), member 3
dog(491084) ATP-binding cassette, sub-family C (CFTR/MRP), member 3
chicken(422099) ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003786 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003786 Rosetta Predictions human pricing
NM_080581 Rosetta Predictions rat pricing
NM_029600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216853 predicted 3936
2 SASI_Hs01_00216855 predicted 3296
3 SASI_Hs01_00216856 predicted 1215
4 SASI_Hs01_00216857 predicted 1706
5 SASI_Hs01_00216858 predicted 2598
6 SASI_Hs01_00216859 predicted 3579
7 SASI_Hs01_00216860 predicted 1544
8 SASI_Hs01_00216861 predicted 3552
9 SASI_Hs01_00216862 predicted 1160
10 SASI_Hs02_00336289 predicted 2359
11 SASI_Hs01_00216854 predicted 1826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267244 predicted 3574
2 SASI_Rn02_00267245 predicted 1492
3 SASI_Rn02_00267246 predicted 2579
4 SASI_Rn02_00267247 predicted 4030
5 SASI_Rn02_00267248 predicted 3044
6 SASI_Rn02_00267249 predicted 4169
7 SASI_Rn02_00267250 predicted 2617
8 SASI_Rn02_00267251 predicted 2909
9 SASI_Rn02_00267252 predicted 2396
10 SASI_Rn02_00267253 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092941 predicted 2916
2 SASI_Mm02_00335574 predicted 2398
3 SASI_Mm01_00092942 predicted 4401
4 SASI_Mm01_00092943 predicted 1797
5 SASI_Mm01_00092944 predicted 2593
6 SASI_Mm01_00092945 predicted 1044
7 SASI_Mm01_00092946 predicted 3905
8 SASI_Mm01_00092948 predicted 4449
9 SASI_Mm01_00092949 predicted 2847
10 SASI_Mm01_00092950 predicted 3914
11 SASI_Mm01_00092947 predicted 1380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003786
ABCC3 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003786.3-4723s21c1
Sequence:CCGGACCAAATATGTCCGCAGAATGCTCGAGCATTCTGCGGACATATTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003786.3-3591s21c1
Sequence:CCGGGAGATCATCAGTGATACTAAGCTCGAGCTTAGTATCACTGATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003786.3-3699s21c1
Sequence:CCGGGTGCTCTTTGCTGCACTATTTCTCGAGAAATAGTGCAGCAAAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003786.3-3809s21c1
Sequence:CCGGGATACGAATGATGTCAGATTTCTCGAGAAATCTGACATCATTCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-1161s1c1
Sequence:CCGGCGCTGATCTTACAACACTATTCTCGAGAATAGTGTTGTAAGATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-664s1c1
Sequence:CCGGCGCAAAGAATGTCGACCCTAACTCGAGTTAGGGTCGACATTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-3209s1c1
Sequence:CCGGGCACTGCTGCACAACAAGATACTCGAGTATCTTGTTGTGCAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-3943s1c1
Sequence:CCGGCCGGAATTATTCTGTGCGCTACTCGAGTAGCGCACAGAATAATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-3772s1c1
Sequence:CCGGGCAGGTGACATTTGCTCTGAACTCGAGTTCAGAGCAAATGTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003786
ABCC3 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003786.3-4723s21c1
Sequence:CCGGACCAAATATGTCCGCAGAATGCTCGAGCATTCTGCGGACATATTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003786.3-3591s21c1
Sequence:CCGGGAGATCATCAGTGATACTAAGCTCGAGCTTAGTATCACTGATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003786.3-3699s21c1
Sequence:CCGGGTGCTCTTTGCTGCACTATTTCTCGAGAAATAGTGCAGCAAAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003786.3-3809s21c1
Sequence:CCGGGATACGAATGATGTCAGATTTCTCGAGAAATCTGACATCATTCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-1161s1c1
Sequence:CCGGCGCTGATCTTACAACACTATTCTCGAGAATAGTGTTGTAAGATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-664s1c1
Sequence:CCGGCGCAAAGAATGTCGACCCTAACTCGAGTTAGGGTCGACATTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-3209s1c1
Sequence:CCGGGCACTGCTGCACAACAAGATACTCGAGTATCTTGTTGTGCAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-3943s1c1
Sequence:CCGGCCGGAATTATTCTGTGCGCTACTCGAGTAGCGCACAGAATAATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-3772s1c1
Sequence:CCGGGCAGGTGACATTTGCTCTGAACTCGAGTTCAGAGCAAATGTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003786
ABCC3 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003786.3-4723s21c1
Sequence:CCGGACCAAATATGTCCGCAGAATGCTCGAGCATTCTGCGGACATATTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003786.3-3591s21c1
Sequence:CCGGGAGATCATCAGTGATACTAAGCTCGAGCTTAGTATCACTGATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003786.3-3699s21c1
Sequence:CCGGGTGCTCTTTGCTGCACTATTTCTCGAGAAATAGTGCAGCAAAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003786.3-3809s21c1
Sequence:CCGGGATACGAATGATGTCAGATTTCTCGAGAAATCTGACATCATTCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-1161s1c1
Sequence:CCGGCGCTGATCTTACAACACTATTCTCGAGAATAGTGTTGTAAGATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-664s1c1
Sequence:CCGGCGCAAAGAATGTCGACCCTAACTCGAGTTAGGGTCGACATTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-3209s1c1
Sequence:CCGGGCACTGCTGCACAACAAGATACTCGAGTATCTTGTTGTGCAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-3943s1c1
Sequence:CCGGCCGGAATTATTCTGTGCGCTACTCGAGTAGCGCACAGAATAATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003786.2-3772s1c1
Sequence:CCGGGCAGGTGACATTTGCTCTGAACTCGAGTTCAGAGCAAATGTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029600
VALIDATED
ABCC3 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029600.3-4187s21c1
Sequence:CCGGCGTATGAACTTAGATCCCTTTCTCGAGAAAGGGATCTAAGTTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029600.3-459s21c1
Sequence:CCGGCTTCGGGAGTGCTCATCATATCTCGAGATATGATGAGCACTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029600.3-1149s1c1
Sequence:CCGGCATTGATCTTACACCAATATTCTCGAGAATATTGGTGTAAGATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029600.3-3787s21c1
Sequence:CCGGATCCGACTTGGAGTCTAATATCTCGAGATATTAGACTCCAAGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029600.3-1771s21c1
Sequence:CCGGCCTGTCTTTGTTCAATATCTTCTCGAGAAGATATTGAACAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029600.2-4495s1c1
Sequence:CCGGGCTCAACACAATCATGGACTACTCGAGTAGTCCATGATTGTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029600.2-4712s1c1
Sequence:CCGGGCAAATTGTCTCACAGTGGAACTCGAGTTCCACTGTGAGACAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029600.2-1771s1c1
Sequence:CCGGCCTGTCTTTGTTCAATATCTTCTCGAGAAGATATTGAACAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029600.2-4187s1c1
Sequence:CCGGCGTATGAACTTAGATCCCTTTCTCGAGAAAGGGATCTAAGTTCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029600.2-656s1c1
Sequence:CCGGCCGGAGAATCTTGACACAAATCTCGAGATTTGTGTCAAGATTCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029600
VALIDATED
ABCC3 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029600.3-4187s21c1
Sequence:CCGGCGTATGAACTTAGATCCCTTTCTCGAGAAAGGGATCTAAGTTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029600.3-459s21c1
Sequence:CCGGCTTCGGGAGTGCTCATCATATCTCGAGATATGATGAGCACTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029600.3-1149s1c1
Sequence:CCGGCATTGATCTTACACCAATATTCTCGAGAATATTGGTGTAAGATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029600.3-3787s21c1
Sequence:CCGGATCCGACTTGGAGTCTAATATCTCGAGATATTAGACTCCAAGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029600.3-1771s21c1
Sequence:CCGGCCTGTCTTTGTTCAATATCTTCTCGAGAAGATATTGAACAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029600.2-4495s1c1
Sequence:CCGGGCTCAACACAATCATGGACTACTCGAGTAGTCCATGATTGTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029600.2-4712s1c1
Sequence:CCGGGCAAATTGTCTCACAGTGGAACTCGAGTTCCACTGTGAGACAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029600.2-1771s1c1
Sequence:CCGGCCTGTCTTTGTTCAATATCTTCTCGAGAAGATATTGAACAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029600.2-4187s1c1
Sequence:CCGGCGTATGAACTTAGATCCCTTTCTCGAGAAAGGGATCTAAGTTCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029600.2-656s1c1
Sequence:CCGGCCGGAGAATCTTGACACAAATCTCGAGATTTGTGTCAAGATTCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029600
VALIDATED
ABCC3 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029600.3-4187s21c1
Sequence:CCGGCGTATGAACTTAGATCCCTTTCTCGAGAAAGGGATCTAAGTTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029600.3-459s21c1
Sequence:CCGGCTTCGGGAGTGCTCATCATATCTCGAGATATGATGAGCACTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029600.3-1149s1c1
Sequence:CCGGCATTGATCTTACACCAATATTCTCGAGAATATTGGTGTAAGATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029600.3-3787s21c1
Sequence:CCGGATCCGACTTGGAGTCTAATATCTCGAGATATTAGACTCCAAGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029600.3-1771s21c1
Sequence:CCGGCCTGTCTTTGTTCAATATCTTCTCGAGAAGATATTGAACAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029600.2-4495s1c1
Sequence:CCGGGCTCAACACAATCATGGACTACTCGAGTAGTCCATGATTGTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029600.2-4712s1c1
Sequence:CCGGGCAAATTGTCTCACAGTGGAACTCGAGTTCCACTGTGAGACAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029600.2-1771s1c1
Sequence:CCGGCCTGTCTTTGTTCAATATCTTCTCGAGAAGATATTGAACAAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029600.2-4187s1c1
Sequence:CCGGCGTATGAACTTAGATCCCTTTCTCGAGAAAGGGATCTAAGTTCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029600.2-656s1c1
Sequence:CCGGCCGGAGAATCTTGACACAAATCTCGAGATTTGTGTCAAGATTCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks