EMAIL THIS PAGE TO A FRIEND

ABCC4

ATP-binding cassette, sub-family C (CFTR/MRP), member 4

71 Gene Product Result for
Synonyms: EST170205 MOAT-B MOATB MRP4
UniProtKB ID: O15439, A9Z1Z7, Q8IVZ4, Q8IZN6, Q8NEW8, Q9Y6J2
Gene ID:
Human(10257) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in cellular detoxification as a pump for its substrate, organic anions. Alternative splicing results in multiple splice variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(239273) ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Rat(170924) ATP-binding cassette, subfamily C (CFTR/MRP), member 4
Zebrafish(368620) ATP-binding cassette, sub-family C (CFTR/MRP), member 4
cow(616707) ATP-binding cassette, sub-family C (CFTR/MRP), member 4
cow(515333) ATP-binding cassette, sub-family C (CFTR/MRP), member 4
cow(617150) ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Horse(100050431) ATP-binding cassette, sub-family C (CFTR/MRP), member 4
domestic cat(101096129) ATP-binding cassette, sub-family C (CFTR/MRP), member 4
dog(485523) ATP-binding cassette, sub-family C (CFTR/MRP), member 4
chicken(418791) ATP-binding cassette, sub-family C (CFTR/MRP), member 4
domestic guinea pig(100727718) ATP-binding cassette, sub-family C (CFTR/MRP), member 4
naked mole-rat(101705542) ATP-binding cassette, sub-family C (CFTR/MRP), member 4
sheep(101106534) ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Domestic Rabbit(100354688) ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005845 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033336 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033336 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033336 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105515 Rosetta Predictions human pricing
NM_005845 Rosetta Predictions human pricing
NM_133411 Rosetta Predictions rat pricing
XM_344458 Rosetta Predictions rat pricing
NM_001033336 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324134 predicted 1533
2 SASI_Hs02_00324135 predicted 1736
3 SASI_Hs02_00324136 predicted 1578
4 SASI_Hs02_00324137 predicted 2399
5 SASI_Hs02_00324138 predicted 1830
6 SASI_Hs02_00324139 predicted 2366
7 SASI_Hs02_00324140 predicted 890
8 SASI_Hs02_00324141 predicted 2151
9 SASI_Hs02_00324142 predicted 698
10 SASI_Hs02_00324143 predicted 2405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340385 predicted 1532
2 SASI_Hs02_00340386 predicted 1739
3 SASI_Hs01_00222435 predicted 1571
4 SASI_Hs01_00222436 predicted 2390
5 SASI_Hs02_00340387 predicted 1833
6 SASI_Hs02_00340388 predicted 2364
7 SASI_Hs02_00340389 predicted 884
8 SASI_Hs01_00222439 predicted 2158
9 SASI_Hs01_00222441 predicted 703
10 SASI_Hs02_00340390 predicted 2407
11 SASI_Hs01_00222433 predicted 2412
12 SASI_Hs01_00222434 predicted 2989
13 SASI_Hs01_00222437 predicted 2335
14 SASI_Hs01_00222438 predicted 3146
15 SASI_Hs01_00222440 predicted 2695
16 SASI_Hs01_00222442 predicted 2466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095622 predicted 3113
2 SASI_Rn01_00095623 predicted 3620
3 SASI_Rn01_00095624 predicted 3708
4 SASI_Rn01_00095625 predicted 3545
5 SASI_Rn01_00095626 predicted 948
6 SASI_Rn01_00095627 predicted 3866
7 SASI_Rn01_00095628 predicted 3752
8 SASI_Rn01_00095629 predicted 1638
9 SASI_Rn01_00095630 predicted 3657
10 SASI_Rn02_00267666 predicted 742
11 SASI_Rn01_00095631 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00145875 predicted 5538
2 SASI_Rn01_00145876 predicted 5228
3 SASI_Rn01_00145877 predicted 5416
4 SASI_Rn01_00145878 predicted 5218
5 SASI_Rn01_00145879 predicted 5420
6 SASI_Rn01_00145880 predicted 5480
7 SASI_Rn01_00145881 predicted 5285
8 SASI_Rn01_00145882 predicted 5358
9 SASI_Rn01_00145883 predicted 5452
10 SASI_Rn01_00145884 predicted 5606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033336 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054308 predicted 3607
2 SASI_Mm01_00054309 predicted 3659
3 SASI_Mm01_00054310 predicted 3720
4 SASI_Mm01_00054311 predicted 2679
5 SASI_Mm01_00054312 predicted 1044
6 SASI_Mm01_00054314 predicted 3960
7 SASI_Mm02_00288587 predicted 3676
8 SASI_Mm01_00054316 predicted 3406
9 SASI_Mm01_00054317 predicted 2493
10 SASI_Mm02_00288588 predicted 3758
11 SASI_Mm01_00054313 predicted 1268
12 SASI_Mm01_00054315 predicted 2395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005845
VALIDATED
ABCC4 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005845.2-4324s1c1
Sequence:CCGGCCACCAGTTAAATGCCGTCTACTCGAGTAGACGGCATTTAACTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005845.2-3302s1c1
Sequence:CCGGGCACTCATTAAATCACAAGAACTCGAGTTCTTGTGATTTAATGAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005845.2-2537s1c1
Sequence:CCGGGCTCCGGTATTATTCTTTGATCTCGAGATCAAAGAATAATACCGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005845.2-3560s1c1
Sequence:CCGGGCCTTACAAGAGGTACAACTTCTCGAGAAGTTGTACCTCTTGTAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005845.2-346s1c1
Sequence:CCGGGCCTTCTTTAACAAGAGCAATCTCGAGATTGCTCTTGTTAAAGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005845.3-350s21c1
Sequence:CCGGGCCTTCTTTAACAAGAGCAATCTCGAGATTGCTCTTGTTAAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005845.3-3438s21c1
Sequence:CCGGGAAATTGGACTTCACGATTTACTCGAGTAAATCGTGAAGTCCAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005845.3-4328s21c1
Sequence:CCGGCCACCAGTTAAATGCCGTCTACTCGAGTAGACGGCATTTAACTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005845.3-2541s21c1
Sequence:CCGGGCTCCGGTATTATTCTTTGATCTCGAGATCAAAGAATAATACCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005845.3-3564s21c1
Sequence:CCGGGCCTTACAAGAGGTACAACTTCTCGAGAAGTTGTACCTCTTGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005845
VALIDATED
ABCC4 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005845.2-4324s1c1
Sequence:CCGGCCACCAGTTAAATGCCGTCTACTCGAGTAGACGGCATTTAACTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005845.2-3302s1c1
Sequence:CCGGGCACTCATTAAATCACAAGAACTCGAGTTCTTGTGATTTAATGAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005845.2-2537s1c1
Sequence:CCGGGCTCCGGTATTATTCTTTGATCTCGAGATCAAAGAATAATACCGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005845.2-3560s1c1
Sequence:CCGGGCCTTACAAGAGGTACAACTTCTCGAGAAGTTGTACCTCTTGTAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005845.2-346s1c1
Sequence:CCGGGCCTTCTTTAACAAGAGCAATCTCGAGATTGCTCTTGTTAAAGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005845.3-350s21c1
Sequence:CCGGGCCTTCTTTAACAAGAGCAATCTCGAGATTGCTCTTGTTAAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005845.3-3438s21c1
Sequence:CCGGGAAATTGGACTTCACGATTTACTCGAGTAAATCGTGAAGTCCAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005845.3-4328s21c1
Sequence:CCGGCCACCAGTTAAATGCCGTCTACTCGAGTAGACGGCATTTAACTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005845.3-2541s21c1
Sequence:CCGGGCTCCGGTATTATTCTTTGATCTCGAGATCAAAGAATAATACCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005845.3-3564s21c1
Sequence:CCGGGCCTTACAAGAGGTACAACTTCTCGAGAAGTTGTACCTCTTGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005845
VALIDATED
ABCC4 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005845.2-4324s1c1
Sequence:CCGGCCACCAGTTAAATGCCGTCTACTCGAGTAGACGGCATTTAACTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005845.2-3302s1c1
Sequence:CCGGGCACTCATTAAATCACAAGAACTCGAGTTCTTGTGATTTAATGAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005845.2-2537s1c1
Sequence:CCGGGCTCCGGTATTATTCTTTGATCTCGAGATCAAAGAATAATACCGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005845.2-3560s1c1
Sequence:CCGGGCCTTACAAGAGGTACAACTTCTCGAGAAGTTGTACCTCTTGTAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005845.2-346s1c1
Sequence:CCGGGCCTTCTTTAACAAGAGCAATCTCGAGATTGCTCTTGTTAAAGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005845.3-350s21c1
Sequence:CCGGGCCTTCTTTAACAAGAGCAATCTCGAGATTGCTCTTGTTAAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005845.3-3438s21c1
Sequence:CCGGGAAATTGGACTTCACGATTTACTCGAGTAAATCGTGAAGTCCAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005845.3-4328s21c1
Sequence:CCGGCCACCAGTTAAATGCCGTCTACTCGAGTAGACGGCATTTAACTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005845.3-2541s21c1
Sequence:CCGGGCTCCGGTATTATTCTTTGATCTCGAGATCAAAGAATAATACCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005845.3-3564s21c1
Sequence:CCGGGCCTTACAAGAGGTACAACTTCTCGAGAAGTTGTACCTCTTGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033336
VALIDATED
ABCC4 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033336.2-3401s21c1
Sequence:CCGGAGATCTTGACAACCGAAATTGCTCGAGCAATTTCGGTTGTCAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033336.2-868s21c1
Sequence:CCGGTTCTCGTCACTGCGGAGTAAACTCGAGTTTACTCCGCAGTGACGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033336.2-3966s21c1
Sequence:CCGGGGTATACTTCAGACGGAATTACTCGAGTAATTCCGTCTGAAGTATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033336.2-4991s21c1
Sequence:CCGGTCGTTAGAGTCACCGACTTTACTCGAGTAAAGTCGGTGACTCTAACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033336.2-332s21c1
Sequence:CCGGCCTTAACAAAGGCAATCATAACTCGAGTTATGATTGCCTTTGTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033336
VALIDATED
ABCC4 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033336.2-3401s21c1
Sequence:CCGGAGATCTTGACAACCGAAATTGCTCGAGCAATTTCGGTTGTCAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033336.2-868s21c1
Sequence:CCGGTTCTCGTCACTGCGGAGTAAACTCGAGTTTACTCCGCAGTGACGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033336.2-3966s21c1
Sequence:CCGGGGTATACTTCAGACGGAATTACTCGAGTAATTCCGTCTGAAGTATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033336.2-4991s21c1
Sequence:CCGGTCGTTAGAGTCACCGACTTTACTCGAGTAAAGTCGGTGACTCTAACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033336.2-332s21c1
Sequence:CCGGCCTTAACAAAGGCAATCATAACTCGAGTTATGATTGCCTTTGTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033336
VALIDATED
ABCC4 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033336.2-3401s21c1
Sequence:CCGGAGATCTTGACAACCGAAATTGCTCGAGCAATTTCGGTTGTCAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033336.2-868s21c1
Sequence:CCGGTTCTCGTCACTGCGGAGTAAACTCGAGTTTACTCCGCAGTGACGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033336.2-3966s21c1
Sequence:CCGGGGTATACTTCAGACGGAATTACTCGAGTAATTCCGTCTGAAGTATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033336.2-4991s21c1
Sequence:CCGGTCGTTAGAGTCACCGACTTTACTCGAGTAAAGTCGGTGACTCTAACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033336.2-332s21c1
Sequence:CCGGCCTTAACAAAGGCAATCATAACTCGAGTTATGATTGCCTTTGTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)