EMAIL THIS PAGE TO A FRIEND

ABCC5

ATP-binding cassette, sub-family C (CFTR/MRP), member 5

274 Gene Product Result for
Synonyms: ABC33 EST277145 MOAT-C MOATC MRP5 SMRP pABC11
Gene ID:
Human(10057) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that this protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. This protein may be involved in resistance to thiopurines in acute lymphoblastic leukemia and antiretroviral nucleoside analogs in HIV-infected patients. Alternative splicing of this gene has been detected; however, the complete sequence and translation initiation site is unclear. [provided by RefSeq, Jul 2008]
Mouse(27416) ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Rat(116721) ATP-binding cassette, subfamily C (CFTR/MRP), member 5
sheep(101123431) ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Domestic Rabbit(100351084) ATP-binding cassette, sub-family C (CFTR/MRP), member 5
naked mole-rat(101718472) ATP-binding cassette, sub-family C (CFTR/MRP), member 5
domestic guinea pig(100723026) ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Zebrafish(336147) ATP-binding cassette, sub-family C (CFTR/MRP), member 5
cow(511769) ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Horse(100066941) ATP-binding cassette, sub-family C (CFTR/MRP), member 5
domestic cat(101090542) ATP-binding cassette, sub-family C (CFTR/MRP), member 5
chicken(424947) ATP-binding cassette, sub-family C (CFTR/MRP), member 5
dog(478648) ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005688 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134161 MISSION® esiRNA esiRNA human ABCC5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001023587 Rosetta Predictions human pricing
NM_005688 Rosetta Predictions human pricing
NM_053924 Rosetta Predictions rat pricing
NM_013790 Rosetta Predictions mouse pricing
NM_176839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001023587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034189 predicted 266
2 SASI_Hs01_00034190 predicted 347
3 SASI_Hs01_00034191 predicted 244
4 SASI_Hs01_00034192 predicted 254
5 SASI_Hs01_00034193 predicted 340
6 SASI_Hs01_00034195 predicted 340
7 SASI_Hs01_00034196 predicted 437
8 SASI_Hs01_00034197 predicted 339
9 SASI_Hs01_00034198 predicted 202
10 SASI_Hs02_00307098 predicted 241
11 SASI_Hs01_00034194 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124666 predicted 266
2 SASI_Hs01_00124667 predicted 356
3 SASI_Hs01_00124668 predicted 247
4 SASI_Hs01_00124669 predicted 260
5 SASI_Hs01_00124670 predicted 338
6 SASI_Hs01_00124672 predicted 334
7 SASI_Hs01_00124673 predicted 431
8 SASI_Hs01_00124674 predicted 344
9 SASI_Hs01_00124675 predicted 209
10 SASI_Hs02_00340084 predicted 234
11 SASI_Hs01_00124671 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051872 predicted 1539
2 SASI_Rn01_00051873 predicted 934
3 SASI_Rn01_00051875 predicted 778
4 SASI_Rn01_00051876 predicted 1065
5 SASI_Rn01_00051877 predicted 3093
6 SASI_Rn02_00266870 predicted 3987
7 SASI_Rn01_00051879 predicted 4176
8 SASI_Rn01_00051880 predicted 1872
9 SASI_Rn01_00051881 predicted 3349
10 SASI_Rn02_00266871 predicted 3721
11 SASI_Rn01_00051874 predicted 2354
12 SASI_Rn01_00051878 predicted 1598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132580 predicted 384
2 SASI_Mm01_00132581 predicted 371
3 SASI_Mm01_00132582 predicted 301
4 SASI_Mm01_00132583 predicted 490
5 SASI_Mm01_00132584 predicted 365
6 SASI_Mm01_00132585 predicted 438
7 SASI_Mm01_00132586 predicted 268
8 SASI_Mm01_00132587 predicted 296
9 SASI_Mm01_00132589 predicted 304
10 SASI_Mm02_00322743 predicted 440
11 SASI_Mm01_00132588 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189624 predicted 389
2 SASI_Mm01_00189625 predicted 379
3 SASI_Mm01_00189626 predicted 292
4 SASI_Mm01_00189627 predicted 497
5 SASI_Mm01_00189628 predicted 370
6 SASI_Mm01_00189629 predicted 443
7 SASI_Mm01_00189630 predicted 268
8 SASI_Mm01_00189631 predicted 299
9 SASI_Mm01_00189633 predicted 305
10 SASI_Mm02_00346725 predicted 440
11 SASI_Mm01_00189632 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176839
VALIDATED
ABCC5 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176839.1-418s21c1
Sequence:CCGGCGAGGAGCATTCTAAGGGAAACTCGAGTTTCCCTTAGAATGCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176839.1-858s21c1
Sequence:CCGGGAGCTCAGCAAGGTCTTTATTCTCGAGAATAAAGACCTTGCTGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176839.1-597s21c1
Sequence:CCGGTGTGGCCTTTGTCCAAGTATGCTCGAGCATACTTGGACAAAGGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176839.1-336s21c1
Sequence:CCGGGCCAAGATGCTCTCGAAACAGCTCGAGCTGTTTCGAGAGCATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176839.1-392s21c1
Sequence:CCGGGTGCATTCTCATCTCCAAATTCTCGAGAATTTGGAGATGAGAATGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176839.1-1053s1c1
Sequence:CCGGGCTCTGTATGTTCCCACCAAACTCGAGTTTGGTGGGAACATACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176839.1-418s1c1
Sequence:CCGGCGAGGAGCATTCTAAGGGAAACTCGAGTTTCCCTTAGAATGCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176839.1-701s1c1
Sequence:CCGGCGAAGGGTTGTGTGGATCTTTCTCGAGAAAGATCCACACAACCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176839.1-314s1c1
Sequence:CCGGCGGAGAACAAGATCGTTGGAACTCGAGTTCCAACGATCTTGTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176839.1-804s1c1
Sequence:CCGGGCTGTATTCTGCGGTCAGAATCTCGAGATTCTGACCGCAGAATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176839
VALIDATED
ABCC5 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176839.1-418s21c1
Sequence:CCGGCGAGGAGCATTCTAAGGGAAACTCGAGTTTCCCTTAGAATGCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176839.1-858s21c1
Sequence:CCGGGAGCTCAGCAAGGTCTTTATTCTCGAGAATAAAGACCTTGCTGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176839.1-597s21c1
Sequence:CCGGTGTGGCCTTTGTCCAAGTATGCTCGAGCATACTTGGACAAAGGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176839.1-336s21c1
Sequence:CCGGGCCAAGATGCTCTCGAAACAGCTCGAGCTGTTTCGAGAGCATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176839.1-392s21c1
Sequence:CCGGGTGCATTCTCATCTCCAAATTCTCGAGAATTTGGAGATGAGAATGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176839.1-1053s1c1
Sequence:CCGGGCTCTGTATGTTCCCACCAAACTCGAGTTTGGTGGGAACATACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176839.1-418s1c1
Sequence:CCGGCGAGGAGCATTCTAAGGGAAACTCGAGTTTCCCTTAGAATGCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176839.1-701s1c1
Sequence:CCGGCGAAGGGTTGTGTGGATCTTTCTCGAGAAAGATCCACACAACCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176839.1-314s1c1
Sequence:CCGGCGGAGAACAAGATCGTTGGAACTCGAGTTCCAACGATCTTGTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176839.1-804s1c1
Sequence:CCGGGCTGTATTCTGCGGTCAGAATCTCGAGATTCTGACCGCAGAATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176839
VALIDATED
ABCC5 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176839.1-418s21c1
Sequence:CCGGCGAGGAGCATTCTAAGGGAAACTCGAGTTTCCCTTAGAATGCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176839.1-858s21c1
Sequence:CCGGGAGCTCAGCAAGGTCTTTATTCTCGAGAATAAAGACCTTGCTGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176839.1-597s21c1
Sequence:CCGGTGTGGCCTTTGTCCAAGTATGCTCGAGCATACTTGGACAAAGGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176839.1-336s21c1
Sequence:CCGGGCCAAGATGCTCTCGAAACAGCTCGAGCTGTTTCGAGAGCATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176839.1-392s21c1
Sequence:CCGGGTGCATTCTCATCTCCAAATTCTCGAGAATTTGGAGATGAGAATGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176839.1-1053s1c1
Sequence:CCGGGCTCTGTATGTTCCCACCAAACTCGAGTTTGGTGGGAACATACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176839.1-418s1c1
Sequence:CCGGCGAGGAGCATTCTAAGGGAAACTCGAGTTTCCCTTAGAATGCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176839.1-701s1c1
Sequence:CCGGCGAAGGGTTGTGTGGATCTTTCTCGAGAAAGATCCACACAACCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176839.1-314s1c1
Sequence:CCGGCGGAGAACAAGATCGTTGGAACTCGAGTTCCAACGATCTTGTTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_176839.1-804s1c1
Sequence:CCGGGCTGTATTCTGCGGTCAGAATCTCGAGATTCTGACCGCAGAATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005688
VALIDATED
ABCC5 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005688.2-4339s21c1
Sequence:CCGGCTAGGCTCCGATAGGATTATGCTCGAGCATAATCCTATCGGAGCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005688.2-2328s21c1
Sequence:CCGGCCACATCTTCAATAGTGCTATCTCGAGATAGCACTATTGAAGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005688.2-4714s21c1
Sequence:CCGGAGGTTCAGGGAACCGTTATTACTCGAGTAATAACGGTTCCCTGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005688.2-1173s21c1
Sequence:CCGGATCACGGCTCACAGCATATTTCTCGAGAAATATGCTGTGAGCCGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005688.2-2531s21c1
Sequence:CCGGCACCGCCAGTTGAGATCAATTCTCGAGAATTGATCTCAACTGGCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005688.1-2691s1c1
Sequence:CCGGCCCTTGGCATTCCTGGTTATTCTCGAGAATAACCAGGAATGCCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005688.1-1461s1c1
Sequence:CCGGGCTTTGAAAGTAACACCGTTTCTCGAGAAACGGTGTTACTTTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005688.1-354s1c1
Sequence:CCGGCCCAAGGGAAAGTACCATCATCTCGAGATGATGGTACTTTCCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005688.1-2288s1c1
Sequence:CCGGCCACATCTTCAATAGTGCTATCTCGAGATAGCACTATTGAAGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005688.1-4160s1c1
Sequence:CCGGCCGCCACTGTAAGATTCTGATCTCGAGATCAGAATCTTACAGTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005688
VALIDATED
ABCC5 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005688.2-4339s21c1
Sequence:CCGGCTAGGCTCCGATAGGATTATGCTCGAGCATAATCCTATCGGAGCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005688.2-2328s21c1
Sequence:CCGGCCACATCTTCAATAGTGCTATCTCGAGATAGCACTATTGAAGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005688.2-4714s21c1
Sequence:CCGGAGGTTCAGGGAACCGTTATTACTCGAGTAATAACGGTTCCCTGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005688.2-1173s21c1
Sequence:CCGGATCACGGCTCACAGCATATTTCTCGAGAAATATGCTGTGAGCCGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005688.2-2531s21c1
Sequence:CCGGCACCGCCAGTTGAGATCAATTCTCGAGAATTGATCTCAACTGGCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005688.1-2691s1c1
Sequence:CCGGCCCTTGGCATTCCTGGTTATTCTCGAGAATAACCAGGAATGCCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005688.1-1461s1c1
Sequence:CCGGGCTTTGAAAGTAACACCGTTTCTCGAGAAACGGTGTTACTTTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005688.1-354s1c1
Sequence:CCGGCCCAAGGGAAAGTACCATCATCTCGAGATGATGGTACTTTCCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005688.1-2288s1c1
Sequence:CCGGCCACATCTTCAATAGTGCTATCTCGAGATAGCACTATTGAAGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005688.1-4160s1c1
Sequence:CCGGCCGCCACTGTAAGATTCTGATCTCGAGATCAGAATCTTACAGTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005688
VALIDATED
ABCC5 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005688.2-4339s21c1
Sequence:CCGGCTAGGCTCCGATAGGATTATGCTCGAGCATAATCCTATCGGAGCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005688.2-2328s21c1
Sequence:CCGGCCACATCTTCAATAGTGCTATCTCGAGATAGCACTATTGAAGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005688.2-4714s21c1
Sequence:CCGGAGGTTCAGGGAACCGTTATTACTCGAGTAATAACGGTTCCCTGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005688.2-1173s21c1
Sequence:CCGGATCACGGCTCACAGCATATTTCTCGAGAAATATGCTGTGAGCCGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005688.2-2531s21c1
Sequence:CCGGCACCGCCAGTTGAGATCAATTCTCGAGAATTGATCTCAACTGGCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005688.1-2691s1c1
Sequence:CCGGCCCTTGGCATTCCTGGTTATTCTCGAGAATAACCAGGAATGCCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005688.1-1461s1c1
Sequence:CCGGGCTTTGAAAGTAACACCGTTTCTCGAGAAACGGTGTTACTTTCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005688.1-354s1c1
Sequence:CCGGCCCAAGGGAAAGTACCATCATCTCGAGATGATGGTACTTTCCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005688.1-2288s1c1
Sequence:CCGGCCACATCTTCAATAGTGCTATCTCGAGATAGCACTATTGAAGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005688.1-4160s1c1
Sequence:CCGGCCGCCACTGTAAGATTCTGATCTCGAGATCAGAATCTTACAGTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)