EMAIL THIS PAGE TO A FRIEND

ABCC6

ATP-binding cassette, sub-family C (CFTR/MRP), member 6

81 Gene Product Result for
Synonyms: ABC34 ARA EST349056 GACI2 MLP1 MOAT-E MOATE MRP6 PXE PXE1 URG7
UniProtKB ID: O95255, P78420, Q8TCY8, Q9UMZ7
Gene ID:
Human(368) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein, a member of the MRP subfamily, is involved in multi-drug resistance. Mutations in this gene cause pseudoxanthoma elasticum. Alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(27421) ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Rat(81642) ATP-binding cassette, subfamily C (CFTR/MRP), member 6
chicken(416600) ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Horse(100053637) ATP-binding cassette, sub-family C (CFTR/MRP), member 6
cow(100337270) ATP-binding cassette, sub-family C (CFTR/MRP), member 6
domestic cat(101101022) ATP-binding cassette, sub-family C (CFTR/MRP), member 6
dog(489993) ATP-binding cassette, sub-family C (CFTR/MRP), member 6
domestic guinea pig(100734395) ATP-binding cassette, sub-family C (CFTR/MRP), member 6
naked mole-rat(101724003) ATP-binding cassette, sub-family C (CFTR/MRP), member 6
sheep(101114921) ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Domestic Rabbit(100345582) ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001171 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079528 Rosetta Predictions human pricing
NM_001171 Rosetta Predictions human pricing
NM_031013 Rosetta Predictions rat pricing
NM_018795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313500 predicted 505
2 SASI_Hs02_00313501 predicted 416
3 SASI_Hs02_00313502 predicted 515
4 SASI_Hs02_00313503 predicted 501
5 SASI_Hs02_00313504 predicted 441
6 SASI_Hs02_00313505 predicted 337
7 SASI_Hs02_00313506 predicted 335
8 SASI_Hs02_00313507 predicted 497
9 SASI_Hs02_00313508 predicted 299
10 SASI_Hs02_00313509 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215478 predicted 1935
2 SASI_Hs01_00215479 predicted 3489
3 SASI_Hs01_00215480 predicted 1705
4 SASI_Hs01_00215481 predicted 795
5 SASI_Hs01_00215483 predicted 852
6 SASI_Hs01_00215484 predicted 3181
7 SASI_Hs01_00215485 predicted 1007
8 SASI_Hs02_00331296 predicted 3604
9 SASI_Hs01_00215477 predicted 2813
10 SASI_Hs02_00331297 predicted 413
11 SASI_Hs01_00215482 predicted 2784
12 SASI_Hs01_00215486 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066900 predicted 3849
2 SASI_Rn01_00066901 predicted 1670
3 SASI_Rn01_00066902 predicted 3868
4 SASI_Rn01_00066903 predicted 3323
5 SASI_Rn01_00066904 predicted 3848
6 SASI_Rn01_00066905 predicted 4080
7 SASI_Rn02_00264204 predicted 1125
8 SASI_Rn01_00066906 predicted 1363
9 SASI_Rn01_00066907 predicted 3851
10 SASI_Rn01_00066908 predicted 748
11 SASI_Rn01_00066909 predicted 3175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324118 predicted 4491
2 SASI_Mm01_00073816 predicted 2120
3 SASI_Mm01_00073812 predicted 2305
4 SASI_Mm01_00073815 predicted 3536
5 SASI_Mm01_00073817 predicted 1296
6 SASI_Mm01_00073818 predicted 1004
7 SASI_Mm01_00073819 predicted 749
8 SASI_Mm01_00073820 predicted 753
9 SASI_Mm02_00324119 predicted 3531
10 SASI_Mm01_00073821 predicted 3357
11 SASI_Mm01_00073813 predicted 4022
12 SASI_Mm01_00073814 predicted 4332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018795
ABCC6 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018795.1-4608s1c1
Sequence:CCGGGCAGAGAAAGTGATGGAGTATCTCGAGATACTCCATCACTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018795.1-1483s1c1
Sequence:CCGGCCATGCTCAGAACTGTGAGAACTCGAGTTCTCACAGTTCTGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018795.1-3446s1c1
Sequence:CCGGCGATGCTCTCATGGATGAGAACTCGAGTTCTCATCCATGAGAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018795.1-2163s1c1
Sequence:CCGGCCCTGGTTGCAGAAAGTTCTACTCGAGTAGAACTTTCTGCAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018795.1-3270s1c1
Sequence:CCGGCTACCTCTCATGGTCCTCTATCTCGAGATAGAGGACCATGAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018795
ABCC6 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018795.1-4608s1c1
Sequence:CCGGGCAGAGAAAGTGATGGAGTATCTCGAGATACTCCATCACTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018795.1-1483s1c1
Sequence:CCGGCCATGCTCAGAACTGTGAGAACTCGAGTTCTCACAGTTCTGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018795.1-3446s1c1
Sequence:CCGGCGATGCTCTCATGGATGAGAACTCGAGTTCTCATCCATGAGAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018795.1-2163s1c1
Sequence:CCGGCCCTGGTTGCAGAAAGTTCTACTCGAGTAGAACTTTCTGCAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018795.1-3270s1c1
Sequence:CCGGCTACCTCTCATGGTCCTCTATCTCGAGATAGAGGACCATGAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018795
ABCC6 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018795.1-4608s1c1
Sequence:CCGGGCAGAGAAAGTGATGGAGTATCTCGAGATACTCCATCACTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018795.1-1483s1c1
Sequence:CCGGCCATGCTCAGAACTGTGAGAACTCGAGTTCTCACAGTTCTGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018795.1-3446s1c1
Sequence:CCGGCGATGCTCTCATGGATGAGAACTCGAGTTCTCATCCATGAGAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018795.1-2163s1c1
Sequence:CCGGCCCTGGTTGCAGAAAGTTCTACTCGAGTAGAACTTTCTGCAACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018795.1-3270s1c1
Sequence:CCGGCTACCTCTCATGGTCCTCTATCTCGAGATAGAGGACCATGAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001171
VALIDATED
ABCC6 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001171.2-3331s1c1
Sequence:CCGGGCCTGTATGTGGTTAGCTCATCTCGAGATGAGCTAACCACATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001171.2-3482s1c1
Sequence:CCGGCGTAGATGAAAGCCAGAGGATCTCGAGATCCTCTGGCTTTCATCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001171.2-1961s1c1
Sequence:CCGGCCACAGAATAAACCTCACGGTCTCGAGACCGTGAGGTTTATTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001171.2-3111s1c1
Sequence:CCGGCGATCTCCCATCAGCTTCTTTCTCGAGAAAGAAGCTGATGGGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001171.2-1692s1c1
Sequence:CCGGGTGGCCGAGAATGCTATGAATCTCGAGATTCATAGCATTCTCGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171.5-2490s21c1
Sequence:CCGGCCCAGGCTGATTGGATCATAGCTCGAGCTATGATCCAATCAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171.5-3828s21c1
Sequence:CCGGAGATCGAGTTCCGGGACTTTGCTCGAGCAAAGTCCCGGAACTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171.5-1347s21c1
Sequence:CCGGTCGTGGTCTGCTTCGTCTATCCTCGAGGATAGACGAAGCAGACCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001171.5-4628s21c1
Sequence:CCGGTCGATAGCTCCACACGATATTCTCGAGAATATCGTGTGGAGCTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171.5-3155s21c1
Sequence:CCGGCCCATTGGTCACCTGCTAAACCTCGAGGTTTAGCAGGTGACCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001171
VALIDATED
ABCC6 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001171.2-3331s1c1
Sequence:CCGGGCCTGTATGTGGTTAGCTCATCTCGAGATGAGCTAACCACATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001171.2-3482s1c1
Sequence:CCGGCGTAGATGAAAGCCAGAGGATCTCGAGATCCTCTGGCTTTCATCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001171.2-1961s1c1
Sequence:CCGGCCACAGAATAAACCTCACGGTCTCGAGACCGTGAGGTTTATTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001171.2-3111s1c1
Sequence:CCGGCGATCTCCCATCAGCTTCTTTCTCGAGAAAGAAGCTGATGGGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001171.2-1692s1c1
Sequence:CCGGGTGGCCGAGAATGCTATGAATCTCGAGATTCATAGCATTCTCGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171.5-2490s21c1
Sequence:CCGGCCCAGGCTGATTGGATCATAGCTCGAGCTATGATCCAATCAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171.5-3828s21c1
Sequence:CCGGAGATCGAGTTCCGGGACTTTGCTCGAGCAAAGTCCCGGAACTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171.5-1347s21c1
Sequence:CCGGTCGTGGTCTGCTTCGTCTATCCTCGAGGATAGACGAAGCAGACCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001171.5-4628s21c1
Sequence:CCGGTCGATAGCTCCACACGATATTCTCGAGAATATCGTGTGGAGCTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171.5-3155s21c1
Sequence:CCGGCCCATTGGTCACCTGCTAAACCTCGAGGTTTAGCAGGTGACCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001171
VALIDATED
ABCC6 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001171.2-3331s1c1
Sequence:CCGGGCCTGTATGTGGTTAGCTCATCTCGAGATGAGCTAACCACATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001171.2-3482s1c1
Sequence:CCGGCGTAGATGAAAGCCAGAGGATCTCGAGATCCTCTGGCTTTCATCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001171.2-1961s1c1
Sequence:CCGGCCACAGAATAAACCTCACGGTCTCGAGACCGTGAGGTTTATTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001171.2-3111s1c1
Sequence:CCGGCGATCTCCCATCAGCTTCTTTCTCGAGAAAGAAGCTGATGGGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001171.2-1692s1c1
Sequence:CCGGGTGGCCGAGAATGCTATGAATCTCGAGATTCATAGCATTCTCGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171.5-2490s21c1
Sequence:CCGGCCCAGGCTGATTGGATCATAGCTCGAGCTATGATCCAATCAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171.5-3828s21c1
Sequence:CCGGAGATCGAGTTCCGGGACTTTGCTCGAGCAAAGTCCCGGAACTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171.5-1347s21c1
Sequence:CCGGTCGTGGTCTGCTTCGTCTATCCTCGAGGATAGACGAAGCAGACCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001171.5-4628s21c1
Sequence:CCGGTCGATAGCTCCACACGATATTCTCGAGAATATCGTGTGGAGCTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001171.5-3155s21c1
Sequence:CCGGCCCATTGGTCACCTGCTAAACCTCGAGGTTTAGCAGGTGACCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks