EMAIL THIS PAGE TO A FRIEND

ABCC8

ATP-binding cassette, sub-family C (CFTR/MRP), member 8

77 Gene Product Result for
Synonyms: ABC36 HHF1 HI HRINS MRP8 PHHI SUR SUR1 SUR1delta2 TNDM2
UniProtKB ID: Q09428, A6NMX8, E3UYX6, O75948, Q16583
Gene ID:
Human(6833) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternative splicing of this gene has been observed; however, the transcript variants have not been fully described. [provided by RefSeq, Jul 2008]
Mouse(20927) ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Rat(25559) ATP-binding cassette, subfamily C (CFTR/MRP), member 8
Zebrafish(553281) ATP-binding cassette, sub-family C (CFTR/MRP), member 8
chicken(423072) ATP-binding cassette, sub-family C (CFTR/MRP), member 8
domestic cat(101096101) ATP-binding cassette, sub-family C (CFTR/MRP), member 8
cow(538996) ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Horse(100071788) ATP-binding cassette, sub-family C (CFTR/MRP), member 8
dog(485402) ATP-binding cassette, sub-family C (CFTR/MRP), member 8
sheep(101120522) ATP-binding cassette, sub-family C (CFTR/MRP), member 8
naked mole-rat(101705546) ATP-binding cassette, sub-family C (CFTR/MRP), member 8
domestic guinea pig(100722700) ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100012 Anti-ABCC8 antibody produced in rabbit affinity isolated antibody rabbit, mouse, rat, bovine, human
western blot pricing
HPA042318 Anti-ABCC8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2501003 Anti-SUR1/ABCC8 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, canine, human, rat
ELISA, western blot pricing
WH0006833M1 Monoclonal Anti-ABCC8 antibody produced in mouse clone 3G5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404430 Monoclonal Anti-ABCC8 antibody produced in mouse clone 3E1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5200537 Monoclonal Anti-Sur1 - Alkaline Phosphatase antibody produced in mouse clone S289-16, purified immunoglobulin hamster, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200538 Monoclonal Anti-Sur1 - Apc antibody produced in mouse clone S289-16, purified immunoglobulin mouse, rat, hamster
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200529 Monoclonal Anti-Sur1 - Atto 390 antibody produced in mouse clone S289-16, purified immunoglobulin hamster, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200530 Monoclonal Anti-Sur1 - Atto 488 antibody produced in mouse clone S289-16, purified immunoglobulin mouse, rat, hamster
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200531 Monoclonal Anti-Sur1 - Atto 565 antibody produced in mouse clone S289-16, purified immunoglobulin hamster, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200532 Monoclonal Anti-Sur1 - Atto 594 antibody produced in mouse clone S289-16, purified immunoglobulin hamster, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200533 Monoclonal Anti-Sur1 - Atto 633 antibody produced in mouse clone S289-16, purified immunoglobulin mouse, hamster, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200534 Monoclonal Anti-Sur1 - Atto 655 antibody produced in mouse clone S289-16, purified immunoglobulin hamster, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200535 Monoclonal Anti-Sur1 - Atto 680 antibody produced in mouse clone S289-16, purified immunoglobulin hamster, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200536 Monoclonal Anti-Sur1 - Atto 700 antibody produced in mouse clone S289-16, purified immunoglobulin hamster, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200539 Monoclonal Anti-Sur1 - Biotin antibody produced in mouse clone S289-16, purified immunoglobulin rat, mouse, hamster
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200540 Monoclonal Anti-Sur1 - Fitc antibody produced in mouse clone S289-16, purified immunoglobulin rat, mouse, hamster
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200541 Monoclonal Anti-Sur1 - Hrp antibody produced in mouse clone S289-16, purified immunoglobulin rat, mouse, hamster
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200542 Monoclonal Anti-Sur1 - Pe/Atto 594 antibody produced in mouse clone S289-16, purified immunoglobulin hamster, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200543 Monoclonal Anti-Sur1 - Percp antibody produced in mouse clone S289-16, purified immunoglobulin rat, mouse, hamster
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200544 Monoclonal Anti-Sur1 - Rpe antibody produced in mouse clone S289-16, purified immunoglobulin rat, hamster, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200545 Monoclonal Anti-Sur1 - Streptavidin antibody produced in mouse clone S289-16, purified immunoglobulin rat, hamster, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200528 Monoclonal Anti-Sur1 antibody produced in mouse clone S289-16, purified immunoglobulin hamster, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000352 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000352 Rosetta Predictions human pricing
NM_013039 Rosetta Predictions rat pricing
NM_011510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092348 predicted 696
2 SASI_Hs01_00092350 predicted 4427
3 SASI_Hs02_00302391 predicted 3639
4 SASI_Hs01_00092352 predicted 3994
5 SASI_Hs01_00092353 predicted 1454
6 SASI_Hs01_00092354 predicted 4646
7 SASI_Hs01_00092355 predicted 3725
8 SASI_Hs01_00092356 predicted 4325
9 SASI_Hs02_00302392 predicted 3502
10 SASI_Hs02_00302393 predicted 531
11 SASI_Hs01_00092347 predicted 1266
12 SASI_Hs01_00092349 predicted 820
13 SASI_Hs01_00092351 predicted 3981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081094 predicted 1506
2 SASI_Rn01_00081095 predicted 2391
3 SASI_Rn01_00081096 predicted 2370
4 SASI_Rn01_00081097 predicted 1176
5 SASI_Rn01_00081099 predicted 4186
6 SASI_Rn01_00081100 predicted 658
7 SASI_Rn02_00260752 predicted 2020
8 SASI_Rn01_00081101 predicted 3156
9 SASI_Rn01_00081102 predicted 1121
10 SASI_Rn02_00260753 predicted 3869
11 SASI_Rn01_00081093 predicted 3782
12 SASI_Rn01_00081098 predicted 2281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065608 predicted 4405
2 SASI_Mm02_00320821 predicted 3958
3 SASI_Mm01_00065609 predicted 1306
4 SASI_Mm01_00065610 predicted 2486
5 SASI_Mm01_00065611 predicted 267
6 SASI_Mm01_00065612 predicted 1146
7 SASI_Mm01_00065613 predicted 1547
8 SASI_Mm01_00065614 predicted 4306
9 SASI_Mm01_00065616 predicted 1222
10 SASI_Mm02_00320822 predicted 3973
11 SASI_Mm01_00065615 predicted 2105
12 SASI_Mm01_00065617 predicted 2338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000352
ABCC8 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000352.3-1293s21c1
Sequence:CCGGAGCAATACAGACCAAGATTTACTCGAGTAAATCTTGGTCTGTATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000352.3-1493s21c1
Sequence:CCGGTCGGAGTCAGTGCCTTAATTGCTCGAGCAATTAAGGCACTGACTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-4326s1c1
Sequence:CCGGGCACATCATCATTGATGGCATCTCGAGATGCCATCAATGATGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-2512s1c1
Sequence:CCGGCAACGGTACAAGATGGTCATTCTCGAGAATGACCATCTTGTACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-3642s1c1
Sequence:CCGGCGTGTGCTACTTCATCCAGAACTCGAGTTCTGGATGAAGTAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-4787s1c1
Sequence:CCGGGTGCCATCCTTGAGTTCGATACTCGAGTATCGAACTCAAGGATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-486s1c1
Sequence:CCGGCGTGGTCTACTATCACAACATCTCGAGATGTTGTGATAGTAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000352
ABCC8 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000352.3-1293s21c1
Sequence:CCGGAGCAATACAGACCAAGATTTACTCGAGTAAATCTTGGTCTGTATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000352.3-1493s21c1
Sequence:CCGGTCGGAGTCAGTGCCTTAATTGCTCGAGCAATTAAGGCACTGACTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-4326s1c1
Sequence:CCGGGCACATCATCATTGATGGCATCTCGAGATGCCATCAATGATGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-2512s1c1
Sequence:CCGGCAACGGTACAAGATGGTCATTCTCGAGAATGACCATCTTGTACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-3642s1c1
Sequence:CCGGCGTGTGCTACTTCATCCAGAACTCGAGTTCTGGATGAAGTAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-4787s1c1
Sequence:CCGGGTGCCATCCTTGAGTTCGATACTCGAGTATCGAACTCAAGGATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-486s1c1
Sequence:CCGGCGTGGTCTACTATCACAACATCTCGAGATGTTGTGATAGTAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000352
ABCC8 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000352.3-1293s21c1
Sequence:CCGGAGCAATACAGACCAAGATTTACTCGAGTAAATCTTGGTCTGTATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000352.3-1493s21c1
Sequence:CCGGTCGGAGTCAGTGCCTTAATTGCTCGAGCAATTAAGGCACTGACTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-4326s1c1
Sequence:CCGGGCACATCATCATTGATGGCATCTCGAGATGCCATCAATGATGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-2512s1c1
Sequence:CCGGCAACGGTACAAGATGGTCATTCTCGAGAATGACCATCTTGTACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-3642s1c1
Sequence:CCGGCGTGTGCTACTTCATCCAGAACTCGAGTTCTGGATGAAGTAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-4787s1c1
Sequence:CCGGGTGCCATCCTTGAGTTCGATACTCGAGTATCGAACTCAAGGATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000352.2-486s1c1
Sequence:CCGGCGTGGTCTACTATCACAACATCTCGAGATGTTGTGATAGTAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011510
ABCC8 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-4590s1c1
Sequence:CCGGCGTGAGAAAGACCAGCATCTTCTCGAGAAGATGCTGGTCTTTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-743s1c1
Sequence:CCGGCCTTCGTGAATCTGCTGTCAACTCGAGTTGACAGCAGATTCACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-1147s1c1
Sequence:CCGGGCCTATGTCTTGGCTGTACTTCTCGAGAAGTACAGCCAAGACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-2468s1c1
Sequence:CCGGCCTTCGAGAGTCCCTTCAATACTCGAGTATTGAAGGGACTCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-744s1c1
Sequence:CCGGCTTCGTGAATCTGCTGTCAAACTCGAGTTTGACAGCAGATTCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011510
ABCC8 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-4590s1c1
Sequence:CCGGCGTGAGAAAGACCAGCATCTTCTCGAGAAGATGCTGGTCTTTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-743s1c1
Sequence:CCGGCCTTCGTGAATCTGCTGTCAACTCGAGTTGACAGCAGATTCACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-1147s1c1
Sequence:CCGGGCCTATGTCTTGGCTGTACTTCTCGAGAAGTACAGCCAAGACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-2468s1c1
Sequence:CCGGCCTTCGAGAGTCCCTTCAATACTCGAGTATTGAAGGGACTCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-744s1c1
Sequence:CCGGCTTCGTGAATCTGCTGTCAAACTCGAGTTTGACAGCAGATTCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011510
ABCC8 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-4590s1c1
Sequence:CCGGCGTGAGAAAGACCAGCATCTTCTCGAGAAGATGCTGGTCTTTCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-743s1c1
Sequence:CCGGCCTTCGTGAATCTGCTGTCAACTCGAGTTGACAGCAGATTCACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-1147s1c1
Sequence:CCGGGCCTATGTCTTGGCTGTACTTCTCGAGAAGTACAGCCAAGACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-2468s1c1
Sequence:CCGGCCTTCGAGAGTCCCTTCAATACTCGAGTATTGAAGGGACTCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011510.2-744s1c1
Sequence:CCGGCTTCGTGAATCTGCTGTCAAACTCGAGTTTGACAGCAGATTCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks