EMAIL THIS PAGE TO A FRIEND

ABCC9

ATP-binding cassette, sub-family C (CFTR/MRP), member 9

180 Gene Product Result for
Synonyms: ABC37 ATFB12 CANTU CMD1O SUR2
UniProtKB ID: O60706, O60707
Gene ID:
Human(10060) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein is thought to form ATP-sensitive potassium channels in cardiac, skeletal, and vascular and non-vascular smooth muscle. Protein structure suggests a role as the drug-binding channel-modulating subunit of the extra-pancreatic ATP-sensitive potassium channels. Mutations in this gene are associated with cardiomyopathy dilated type 1O. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2011]
Mouse(20928) ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Rat(25560) ATP-binding cassette, subfamily C (CFTR/MRP), member 9
domestic guinea pig(100720522) ATP-binding cassette, sub-family C (CFTR/MRP), member 9
naked mole-rat(101698079) ATP-binding cassette, sub-family C (CFTR/MRP), member 9
sheep(101117577) ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Zebrafish(561160) ATP-binding cassette, sub-family C (CFTR/MRP), member 9
chicken(418200) ATP-binding cassette, sub-family C (CFTR/MRP), member 9
cow(100336551) ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Horse(100064351) ATP-binding cassette, sub-family C (CFTR/MRP), member 9
domestic cat(101096657) ATP-binding cassette, sub-family C (CFTR/MRP), member 9
dog(486638) ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108083 Anti-ABCC9 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, zebrafish, bovine, rabbit, canine, human, rat, pig, horse
western blot pricing
HPA007279 Anti-ABCC9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2100013 Anti-ABCC9 antibody produced in rabbit affinity isolated antibody, lyophilized powder bovine, mouse, canine, human, rat, zebrafish, horse, pig, chicken, rabbit, rabbit
western blot pricing
SAB5200951 Monoclonal Anti-Sur1 - Alkaline Phosphatase antibody produced in mouse clone S323A-31, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200952 Monoclonal Anti-Sur1 - Apc antibody produced in mouse clone S323A-31, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200943 Monoclonal Anti-Sur1 - Atto 390 antibody produced in mouse clone S323A-31, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200944 Monoclonal Anti-Sur1 - Atto 488 antibody produced in mouse clone S323A-31, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200945 Monoclonal Anti-Sur1 - Atto 565 antibody produced in mouse clone S323A-31, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200946 Monoclonal Anti-Sur1 - Atto 594 antibody produced in mouse clone S323A-31, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200947 Monoclonal Anti-Sur1 - Atto 633 antibody produced in mouse clone S323A-31, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200948 Monoclonal Anti-Sur1 - Atto 655 antibody produced in mouse clone S323A-31, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200949 Monoclonal Anti-Sur1 - Atto 680 antibody produced in mouse clone S323A-31, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200950 Monoclonal Anti-Sur1 - Atto 700 antibody produced in mouse clone S323A-31, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200953 Monoclonal Anti-Sur1 - Biotin antibody produced in mouse clone S323A-31, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200954 Monoclonal Anti-Sur1 - Fitc antibody produced in mouse clone S323A-31, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200955 Monoclonal Anti-Sur1 - Hrp antibody produced in mouse clone S323A-31, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200956 Monoclonal Anti-Sur1 - Pe/Atto 594 antibody produced in mouse clone S323A-31, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200957 Monoclonal Anti-Sur1 - Percp antibody produced in mouse clone S323A-31, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200958 Monoclonal Anti-Sur1 - Rpe antibody produced in mouse clone S323A-31, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200959 Monoclonal Anti-Sur1 - Streptavidin antibody produced in mouse clone S323A-31, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200942 Monoclonal Anti-Sur1 antibody produced in mouse clone S323A-31, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200933 Monoclonal Anti-Sur2A - Alkaline Phosphatase antibody produced in mouse clone S319A-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200934 Monoclonal Anti-Sur2A - Apc antibody produced in mouse clone S319A-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200925 Monoclonal Anti-Sur2A - Atto 390 antibody produced in mouse clone S319A-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200926 Monoclonal Anti-Sur2A - Atto 488 antibody produced in mouse clone S319A-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200927 Monoclonal Anti-Sur2A - Atto 565 antibody produced in mouse clone S319A-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200928 Monoclonal Anti-Sur2A - Atto 594 antibody produced in mouse clone S319A-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200929 Monoclonal Anti-Sur2A - Atto 633 antibody produced in mouse clone S319A-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200930 Monoclonal Anti-Sur2A - Atto 655 antibody produced in mouse clone S319A-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200931 Monoclonal Anti-Sur2A - Atto 680 antibody produced in mouse clone S319A-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200932 Monoclonal Anti-Sur2A - Atto 700 antibody produced in mouse clone S319A-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200935 Monoclonal Anti-Sur2A - Biotin antibody produced in mouse clone S319A-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200936 Monoclonal Anti-Sur2A - Fitc antibody produced in mouse clone S319A-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200937 Monoclonal Anti-Sur2A - Hrp antibody produced in mouse clone S319A-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200938 Monoclonal Anti-Sur2A - Pe/Atto 594 antibody produced in mouse clone S319A-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200939 Monoclonal Anti-Sur2A - Percp antibody produced in mouse clone S319A-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200940 Monoclonal Anti-Sur2A - Rpe antibody produced in mouse clone S319A-14, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200941 Monoclonal Anti-Sur2A - Streptavidin antibody produced in mouse clone S319A-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200924 Monoclonal Anti-Sur2A antibody produced in mouse clone S319A-14, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005691 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088351 MISSION® esiRNA esiRNA human ABCC9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005691 Rosetta Predictions human pricing
NM_020297 Rosetta Predictions human pricing
NM_020298 Rosetta Predictions human pricing
NM_013040 Rosetta Predictions rat pricing
NM_001044720 Rosetta Predictions mouse pricing
NM_011511 Rosetta Predictions mouse pricing
NM_021041 Rosetta Predictions mouse pricing
NM_021042 Rosetta Predictions mouse pricing
NM_021043 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061302 predicted 3779
2 SASI_Hs02_00340092 predicted 3725
3 SASI_Hs02_00340093 predicted 4074
4 SASI_Hs01_00061304 predicted 2544
5 SASI_Hs01_00061305 predicted 3223
6 SASI_Hs01_00061306 predicted 1397
7 SASI_Hs01_00061308 predicted 365
8 SASI_Hs01_00061309 predicted 3786
9 SASI_Hs01_00061310 predicted 1352
10 SASI_Hs02_00340094 predicted 1651
11 SASI_Hs01_00061301 predicted 4159
12 SASI_Hs01_00061303 predicted 3718
13 SASI_Hs01_00061307 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191427 predicted 3780
2 SASI_Hs02_00353205 predicted 3724
3 SASI_Hs02_00353206 predicted 4077
4 SASI_Hs01_00191429 predicted 2539
5 SASI_Hs01_00191430 predicted 3220
6 SASI_Hs01_00191431 predicted 1404
7 SASI_Hs01_00191433 predicted 360
8 SASI_Hs01_00191434 predicted 3792
9 SASI_Hs01_00191435 predicted 1355
10 SASI_Hs02_00353207 predicted 1651
11 SASI_Hs01_00191426 predicted 4153
12 SASI_Hs01_00191428 predicted 3714
13 SASI_Hs01_00191432 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220588 predicted 3674
2 SASI_Hs02_00353208 predicted 3623
3 SASI_Hs02_00353209 predicted 3963
4 SASI_Hs01_00220590 predicted 2436
5 SASI_Hs01_00220591 predicted 3113
6 SASI_Hs01_00220592 predicted 1397
7 SASI_Hs01_00220594 predicted 360
8 SASI_Hs01_00220595 predicted 3679
9 SASI_Hs01_00220596 predicted 1358
10 SASI_Hs02_00353210 predicted 1658
11 SASI_Hs01_00220587 predicted 4046
12 SASI_Hs01_00220589 predicted 3607
13 SASI_Hs01_00220593 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076195 predicted 348
2 SASI_Rn01_00076196 predicted 2738
3 SASI_Rn01_00076197 predicted 1370
4 SASI_Rn02_00260754 predicted 1496
5 SASI_Rn01_00076198 predicted 3877
6 SASI_Rn01_00076199 predicted 1446
7 SASI_Rn02_00260755 predicted 4414
8 SASI_Rn02_00260756 predicted 521
9 SASI_Rn01_00076200 predicted 1040
10 SASI_Rn01_00076201 predicted 2331
11 SASI_Rn01_00076202 predicted 4530
12 SASI_Rn01_00076203 predicted 996
13 SASI_Rn01_00076204 predicted 2312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291384 predicted 807
2 SASI_Mm02_00291385 predicted 3778
3 SASI_Mm02_00291386 predicted 1451
4 SASI_Mm02_00291387 predicted 1318
5 SASI_Mm02_00291388 predicted 883
6 SASI_Mm02_00291389 predicted 386
7 SASI_Mm02_00291390 predicted 1201
8 SASI_Mm02_00291391 predicted 4151
9 SASI_Mm02_00291392 predicted 411
10 SASI_Mm02_00291393 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320823 predicted 816
2 SASI_Mm01_00101548 predicted 3815
3 SASI_Mm02_00320824 predicted 1444
4 SASI_Mm02_00320825 predicted 1317
5 SASI_Mm02_00320826 predicted 391
6 SASI_Mm02_00320827 predicted 1203
7 SASI_Mm02_00320828 predicted 3442
8 SASI_Mm02_00320829 predicted 4197
9 SASI_Mm02_00320830 predicted 415
10 SASI_Mm02_00320831 predicted 554
11 SASI_Mm01_00101546 predicted 3826
12 SASI_Mm01_00101547 predicted 3775
13 SASI_Mm01_00101549 predicted 3359
14 SASI_Mm01_00101550 predicted 3360
15 SASI_Mm01_00101551 predicted 3870
16 SASI_Mm01_00101552 predicted 3387
17 SASI_Mm01_00101553 predicted 3347
18 SASI_Mm01_00101554 predicted 3716
19 SASI_Mm01_00101555 predicted 3619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325771 predicted 807
2 SASI_Mm01_00133992 predicted 3815
3 SASI_Mm02_00325772 predicted 1447
4 SASI_Mm02_00325773 predicted 1324
5 SASI_Mm02_00325774 predicted 389
6 SASI_Mm02_00325775 predicted 1197
7 SASI_Mm02_00325776 predicted 3439
8 SASI_Mm02_00325777 predicted 4191
9 SASI_Mm02_00325778 predicted 416
10 SASI_Mm02_00325779 predicted 556
11 SASI_Mm01_00133990 predicted 3820
12 SASI_Mm01_00133991 predicted 3772
13 SASI_Mm01_00133993 predicted 3367
14 SASI_Mm01_00133994 predicted 3355
15 SASI_Mm01_00133995 predicted 3860
16 SASI_Mm01_00133996 predicted 3389
17 SASI_Mm01_00133997 predicted 3341
18 SASI_Mm01_00133998 predicted 3719
19 SASI_Mm01_00133999 predicted 3615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325780 predicted 808
2 SASI_Mm01_00184673 predicted 3707
3 SASI_Mm02_00325781 predicted 1448
4 SASI_Mm02_00325782 predicted 1316
5 SASI_Mm02_00325783 predicted 892
6 SASI_Mm02_00325784 predicted 390
7 SASI_Mm02_00325785 predicted 1200
8 SASI_Mm02_00325786 predicted 4092
9 SASI_Mm02_00325787 predicted 415
10 SASI_Mm02_00325788 predicted 551
11 SASI_Mm01_00184671 predicted 3780
12 SASI_Mm01_00184672 predicted 3731
13 SASI_Mm01_00184674 predicted 3316
14 SASI_Mm01_00184675 predicted 3313
15 SASI_Mm01_00184676 predicted 3813
16 SASI_Mm01_00184677 predicted 3340
17 SASI_Mm01_00184678 predicted 3300
18 SASI_Mm01_00184679 predicted 3670
19 SASI_Mm01_00184680 predicted 3574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166916 predicted 3878
2 SASI_Mm01_00166917 predicted 3831
3 SASI_Mm01_00166918 predicted 3824
4 SASI_Mm01_00166919 predicted 3413
5 SASI_Mm01_00166920 predicted 3411
6 SASI_Mm01_00166921 predicted 3917
7 SASI_Mm01_00166922 predicted 3443
8 SASI_Mm01_00166923 predicted 3399
9 SASI_Mm01_00166924 predicted 3772
10 SASI_Mm01_00166925 predicted 3680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011511
ABCC9 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011511.1-4947s1c1
Sequence:CCGGCGTGTGTTATAGGTTCATTTACTCGAGTAAATGAACCTATAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011511.1-591s1c1
Sequence:CCGGGCCTTTATTACAAAGACGATACTCGAGTATCGTCTTTGTAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011511.1-4241s1c1
Sequence:CCGGCGACATATTTGACGGAAAGATCTCGAGATCTTTCCGTCAAATATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011511.1-1316s1c1
Sequence:CCGGGCTGGCTATGATATACAATAACTCGAGTTATTGTATATCATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011511.1-900s1c1
Sequence:CCGGGCGATTGGAAAGTTGCCGATACTCGAGTATCGGCAACTTTCCAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011511
ABCC9 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011511.1-4947s1c1
Sequence:CCGGCGTGTGTTATAGGTTCATTTACTCGAGTAAATGAACCTATAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011511.1-591s1c1
Sequence:CCGGGCCTTTATTACAAAGACGATACTCGAGTATCGTCTTTGTAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011511.1-4241s1c1
Sequence:CCGGCGACATATTTGACGGAAAGATCTCGAGATCTTTCCGTCAAATATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011511.1-1316s1c1
Sequence:CCGGGCTGGCTATGATATACAATAACTCGAGTTATTGTATATCATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011511.1-900s1c1
Sequence:CCGGGCGATTGGAAAGTTGCCGATACTCGAGTATCGGCAACTTTCCAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011511
ABCC9 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011511.1-4947s1c1
Sequence:CCGGCGTGTGTTATAGGTTCATTTACTCGAGTAAATGAACCTATAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011511.1-591s1c1
Sequence:CCGGGCCTTTATTACAAAGACGATACTCGAGTATCGTCTTTGTAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011511.1-4241s1c1
Sequence:CCGGCGACATATTTGACGGAAAGATCTCGAGATCTTTCCGTCAAATATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011511.1-1316s1c1
Sequence:CCGGGCTGGCTATGATATACAATAACTCGAGTTATTGTATATCATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011511.1-900s1c1
Sequence:CCGGGCGATTGGAAAGTTGCCGATACTCGAGTATCGGCAACTTTCCAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005691
ABCC9 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-2815s1c1
Sequence:CCGGCGGGCCATGTATTCAAGAGAACTCGAGTTCTCTTGAATACATGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-970s1c1
Sequence:CCGGCGTGTGAATGAAACCCAGAATCTCGAGATTCTGGGTTTCATTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-4046s1c1
Sequence:CCGGGCAGTGGGAAATCATCGTTATCTCGAGATAACGATGATTTCCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-544s1c1
Sequence:CCGGGCTGTGGAGATCAATGTCATTCTCGAGAATGACATTGATCTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-1681s1c1
Sequence:CCGGGCCAGTGGAAACAATCTGAAACTCGAGTTTCAGATTGTTTCCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005691.2-1417s21c1
Sequence:CCGGTTGCGCCAATTCAGTACTTTACTCGAGTAAAGTACTGAATTGGCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005691.2-1350s21c1
Sequence:CCGGGGCGTGATTCTGCTCTATAATCTCGAGATTATAGAGCAGAATCACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005691
ABCC9 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-2815s1c1
Sequence:CCGGCGGGCCATGTATTCAAGAGAACTCGAGTTCTCTTGAATACATGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-970s1c1
Sequence:CCGGCGTGTGAATGAAACCCAGAATCTCGAGATTCTGGGTTTCATTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-4046s1c1
Sequence:CCGGGCAGTGGGAAATCATCGTTATCTCGAGATAACGATGATTTCCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-544s1c1
Sequence:CCGGGCTGTGGAGATCAATGTCATTCTCGAGAATGACATTGATCTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-1681s1c1
Sequence:CCGGGCCAGTGGAAACAATCTGAAACTCGAGTTTCAGATTGTTTCCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005691.2-1417s21c1
Sequence:CCGGTTGCGCCAATTCAGTACTTTACTCGAGTAAAGTACTGAATTGGCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005691.2-1350s21c1
Sequence:CCGGGGCGTGATTCTGCTCTATAATCTCGAGATTATAGAGCAGAATCACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005691
ABCC9 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-2815s1c1
Sequence:CCGGCGGGCCATGTATTCAAGAGAACTCGAGTTCTCTTGAATACATGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-970s1c1
Sequence:CCGGCGTGTGAATGAAACCCAGAATCTCGAGATTCTGGGTTTCATTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-4046s1c1
Sequence:CCGGGCAGTGGGAAATCATCGTTATCTCGAGATAACGATGATTTCCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-544s1c1
Sequence:CCGGGCTGTGGAGATCAATGTCATTCTCGAGAATGACATTGATCTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005691.1-1681s1c1
Sequence:CCGGGCCAGTGGAAACAATCTGAAACTCGAGTTTCAGATTGTTTCCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005691.2-1417s21c1
Sequence:CCGGTTGCGCCAATTCAGTACTTTACTCGAGTAAAGTACTGAATTGGCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005691.2-1350s21c1
Sequence:CCGGGGCGTGATTCTGCTCTATAATCTCGAGATTATAGAGCAGAATCACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks