EMAIL THIS PAGE TO A FRIEND

ABCD1

ATP-binding cassette, sub-family D (ALD), member 1

75 Gene Product Result for
Synonyms: ABC42 ALD ALDP AMN
UniProtKB ID: P33897, Q6GTZ2
Gene ID:
Human(215) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein is likely involved in the peroxisomal transport or catabolism of very long chain fatty acids. Defects in this gene have been identified as the underlying cause of adrenoleukodystrophy, an X-chromosome recessively inherited demyelinating disorder of the nervous system. [provided by RefSeq, Jul 2008]
Mouse(11666) ATP-binding cassette, sub-family D (ALD), member 1
Rat(363516) ATP-binding cassette, subfamily D (ALD), member 1
Zebrafish(566367) ATP-binding cassette, sub-family D (ALD), member 1
dog(612520) ATP-binding cassette, sub-family D (ALD), member 1
cow(515178) ATP-binding cassette, sub-family D (ALD), member 1
domestic cat(101088223) ATP-binding cassette, sub-family D (ALD), member 1
sheep(101122673) ATP-binding cassette, sub-family D (ALD), member 1
Domestic Rabbit(100328741) ATP-binding cassette, sub-family D (ALD), member 1
naked mole-rat(101720585) ATP-binding cassette, sub-family D (ALD), member 1
domestic guinea pig(100713152) ATP-binding cassette, sub-family D (ALD), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000033 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000033 Rosetta Predictions human pricing
NM_001108821 Rosetta Predictions rat pricing
NM_007435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196438 predicted 837
2 SASI_Hs01_00196439 predicted 1378
3 SASI_Hs01_00196440 predicted 1013
4 SASI_Hs01_00196441 predicted 1634
5 SASI_Hs01_00196443 predicted 2063
6 SASI_Hs01_00196444 predicted 2253
7 SASI_Hs01_00196445 predicted 692
8 SASI_Hs02_00301711 predicted 899
9 SASI_Hs01_00196446 predicted 1568
10 SASI_Hs01_00196447 predicted 1463
11 SASI_Hs01_00196442 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242405 predicted 746
2 SASI_Rn02_00242406 predicted 746
3 SASI_Rn02_00242407 predicted 1056
4 SASI_Rn02_00242408 predicted 2381
5 SASI_Rn02_00242409 predicted 970
6 SASI_Rn02_00242410 predicted 2296
7 SASI_Rn02_00242411 predicted 1859
8 SASI_Rn02_00242412 predicted 475
9 SASI_Rn02_00242413 predicted 1699
10 SASI_Rn02_00242414 predicted 1784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038222 predicted 753
2 SASI_Mm01_00038223 predicted 2381
3 SASI_Mm01_00038224 predicted 972
4 SASI_Mm01_00038225 predicted 752
5 SASI_Mm01_00038226 predicted 2302
6 SASI_Mm01_00038227 predicted 1063
7 SASI_Mm01_00038228 predicted 1864
8 SASI_Mm01_00038229 predicted 1411
9 SASI_Mm01_00038230 predicted 1705
10 SASI_Mm01_00038231 predicted 2445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000033
VALIDATED
ABCD1 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family D (ALD), member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000033.3-1540s21c1
Sequence:CCGGCGCACAGAAGCCTTCACTATTCTCGAGAATAGTGAAGGCTTCTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000033.3-591s21c1
Sequence:CCGGAGCTGGCATGAACCGGGTATTCTCGAGAATACCCGGTTCATGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000033.3-1377s21c1
Sequence:CCGGGTATGTTATGCTGGAGCAGTTCTCGAGAACTGCTCCAGCATAACATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000033.3-3084s21c1
Sequence:CCGGCGTTCCGTGGGATGCCATAAACTCGAGTTTATGGCATCCCACGGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000033.2-1527s1c1
Sequence:CCGGCGCACAGAAGCCTTCACTATTCTCGAGAATAGTGAAGGCTTCTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000033.2-696s1c1
Sequence:CCGGCGCACCTTCCTGTCGGTGTATCTCGAGATACACCGACAGGAAGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000033.2-1364s1c1
Sequence:CCGGGTATGTTATGCTGGAGCAGTTCTCGAGAACTGCTCCAGCATAACATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000033
VALIDATED
ABCD1 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family D (ALD), member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000033.3-1540s21c1
Sequence:CCGGCGCACAGAAGCCTTCACTATTCTCGAGAATAGTGAAGGCTTCTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000033.3-591s21c1
Sequence:CCGGAGCTGGCATGAACCGGGTATTCTCGAGAATACCCGGTTCATGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000033.3-1377s21c1
Sequence:CCGGGTATGTTATGCTGGAGCAGTTCTCGAGAACTGCTCCAGCATAACATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000033.3-3084s21c1
Sequence:CCGGCGTTCCGTGGGATGCCATAAACTCGAGTTTATGGCATCCCACGGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000033.2-1527s1c1
Sequence:CCGGCGCACAGAAGCCTTCACTATTCTCGAGAATAGTGAAGGCTTCTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000033.2-696s1c1
Sequence:CCGGCGCACCTTCCTGTCGGTGTATCTCGAGATACACCGACAGGAAGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000033.2-1364s1c1
Sequence:CCGGGTATGTTATGCTGGAGCAGTTCTCGAGAACTGCTCCAGCATAACATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000033
VALIDATED
ABCD1 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family D (ALD), member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000033.3-1540s21c1
Sequence:CCGGCGCACAGAAGCCTTCACTATTCTCGAGAATAGTGAAGGCTTCTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000033.3-591s21c1
Sequence:CCGGAGCTGGCATGAACCGGGTATTCTCGAGAATACCCGGTTCATGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000033.3-1377s21c1
Sequence:CCGGGTATGTTATGCTGGAGCAGTTCTCGAGAACTGCTCCAGCATAACATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000033.3-3084s21c1
Sequence:CCGGCGTTCCGTGGGATGCCATAAACTCGAGTTTATGGCATCCCACGGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000033.2-1527s1c1
Sequence:CCGGCGCACAGAAGCCTTCACTATTCTCGAGAATAGTGAAGGCTTCTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000033.2-696s1c1
Sequence:CCGGCGCACCTTCCTGTCGGTGTATCTCGAGATACACCGACAGGAAGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000033.2-1364s1c1
Sequence:CCGGGTATGTTATGCTGGAGCAGTTCTCGAGAACTGCTCCAGCATAACATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007435
VALIDATED
ABCD1 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family D (ALD), member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-2936s21c1
Sequence:CCGGTCCTGACTCTATACCAGTATGCTCGAGCATACTGGTATAGAGTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-1703s21c1
Sequence:CCGGACGAGATGTTCCAGGTATTTGCTCGAGCAAATACCTGGAACATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-2021s21c1
Sequence:CCGGCATACAGTGGTGTACTCTATACTCGAGTATAGAGTACACCACTGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-1645s21c1
Sequence:CCGGAGGATCATGTCATCTTATAAGCTCGAGCTTATAAGATGACATGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-2102s21c1
Sequence:CCGGTGCGTGACCAAGTGATCTATCCTCGAGGATAGATCACTTGGTCACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007435.1-3054s1c1
Sequence:CCGGCCCAAATCCTTGTCATTGTTTCTCGAGAAACAATGACAAGGATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007435.1-1354s1c1
Sequence:CCGGGCACTACTACAGCACTCCTATCTCGAGATAGGAGTGCTGTAGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007435.1-1641s1c1
Sequence:CCGGCGAAAGGATCATGTCATCTTACTCGAGTAAGATGACATGATCCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007435.1-753s1c1
Sequence:CCGGCCGAACTTTCCTGTCTGTGTACTCGAGTACACAGACAGGAAAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007435.1-1979s1c1
Sequence:CCGGGCAAGAGTTCTCTGTTCCGAACTCGAGTTCGGAACAGAGAACTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007435
VALIDATED
ABCD1 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family D (ALD), member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-2936s21c1
Sequence:CCGGTCCTGACTCTATACCAGTATGCTCGAGCATACTGGTATAGAGTCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-1703s21c1
Sequence:CCGGACGAGATGTTCCAGGTATTTGCTCGAGCAAATACCTGGAACATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-2021s21c1
Sequence:CCGGCATACAGTGGTGTACTCTATACTCGAGTATAGAGTACACCACTGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-1645s21c1
Sequence:CCGGAGGATCATGTCATCTTATAAGCTCGAGCTTATAAGATGACATGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-2102s21c1
Sequence:CCGGTGCGTGACCAAGTGATCTATCCTCGAGGATAGATCACTTGGTCACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007435.1-3054s1c1
Sequence:CCGGCCCAAATCCTTGTCATTGTTTCTCGAGAAACAATGACAAGGATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007435.1-1354s1c1
Sequence:CCGGGCACTACTACAGCACTCCTATCTCGAGATAGGAGTGCTGTAGTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007435.1-1641s1c1
Sequence:CCGGCGAAAGGATCATGTCATCTTACTCGAGTAAGATGACATGATCCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007435.1-753s1c1
Sequence:CCGGCCGAACTTTCCTGTCTGTGTACTCGAGTACACAGACAGGAAAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007435.1-1979s1c1
Sequence:CCGGGCAAGAGTTCTCTGTTCCGAACTCGAGTTCGGAACAGAGAACTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007435
VALIDATED
ABCD1 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family D (ALD), member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-2936s21c1
Sequence:CCGGTCCTGACTCTATACCAGTATGCTCGAGCATACTGGTATAGAGTCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-1703s21c1
Sequence:CCGGACGAGATGTTCCAGGTATTTGCTCGAGCAAATACCTGGAACATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-2021s21c1
Sequence:CCGGCATACAGTGGTGTACTCTATACTCGAGTATAGAGTACACCACTGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-1645s21c1
Sequence:CCGGAGGATCATGTCATCTTATAAGCTCGAGCTTATAAGATGACATGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007435.1-2102s21c1
Sequence:CCGGTGCGTGACCAAGTGATCTATCCTCGAGGATAGATCACTTGGTCACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007435.1-3054s1c1
Sequence:CCGGCCCAAATCCTTGTCATTGTTTCTCGAGAAACAATGACAAGGATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007435.1-1354s1c1
Sequence:CCGGGCACTACTACAGCACTCCTATCTCGAGATAGGAGTGCTGTAGTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007435.1-1641s1c1
Sequence:CCGGCGAAAGGATCATGTCATCTTACTCGAGTAAGATGACATGATCCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007435.1-753s1c1
Sequence:CCGGCCGAACTTTCCTGTCTGTGTACTCGAGTACACAGACAGGAAAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007435.1-1979s1c1
Sequence:CCGGGCAAGAGTTCTCTGTTCCGAACTCGAGTTCGGAACAGAGAACTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)