EMAIL THIS PAGE TO A FRIEND

ABCD2

ATP-binding cassette, sub-family D (ALD), member 2

94 Gene Product Result for
Synonyms: ABC39 ALDL1 ALDR ALDRP hALDR
UniProtKB ID: Q9UBJ2, B2RAM3, Q13210, Q2M3H9
Gene ID:
Human(225) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown; however this protein is speculated to function as a dimerization partner of ABCD1 and/or other peroxisomal ABC transporters. Mutations in this gene have been observed in patients with adrenoleukodystrophy, a severe demyelinating disease. This gene has been identified as a candidate for a modifier gene, accounting for the extreme variation among adrenoleukodystrophy phenotypes. This gene is also a candidate for a complement group of Zellweger syndrome, a genetically heterogeneous disorder of peroxisomal biogenesis. [provided by RefSeq, Jul 2008]
Mouse(26874) ATP-binding cassette, sub-family D (ALD), member 2
Rat(84356) ATP-binding cassette, subfamily D (ALD), member 2
Zebrafish(100537809) ATP-binding cassette, sub-family D (ALD), member 2
cow(526436) ATP-binding cassette, sub-family D (ALD), member 2
domestic cat(101095424) ATP-binding cassette, sub-family D (ALD), member 2
dog(477643) ATP-binding cassette, sub-family D (ALD), member 2
chicken(417694) ATP-binding cassette, sub-family D (ALD), member 2
domestic guinea pig(100715583) ATP-binding cassette, sub-family D (ALD), member 2
naked mole-rat(101706287) ATP-binding cassette, sub-family D (ALD), member 2
sheep(101119199) ATP-binding cassette, sub-family D (ALD), member 2
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011994 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011994 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011994 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005164 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005164 Rosetta Predictions human pricing
NM_033352 Rosetta Predictions rat pricing
NM_011994 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118686 predicted 1498
2 SASI_Hs02_00339107 predicted 2117
3 SASI_Hs01_00118688 predicted 1302
4 SASI_Hs01_00118689 predicted 2064
5 SASI_Hs01_00118690 predicted 1211
6 SASI_Hs01_00118691 predicted 1632
7 SASI_Hs01_00118692 predicted 1645
8 SASI_Hs01_00118693 predicted 1773
9 SASI_Hs01_00118694 predicted 1387
10 SASI_Hs01_00118695 predicted 1492
11 SASI_Hs01_00118687 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265539 predicted 1011
2 SASI_Rn02_00265540 predicted 633
3 SASI_Rn02_00265541 predicted 1417
4 SASI_Rn02_00265542 predicted 1064
5 SASI_Rn02_00265543 predicted 1166
6 SASI_Rn02_00265544 predicted 984
7 SASI_Rn02_00265545 predicted 1125
8 SASI_Rn02_00265546 predicted 1617
9 SASI_Rn02_00265547 predicted 1792
10 SASI_Rn02_00265548 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158209 predicted 1685
2 SASI_Mm01_00158210 predicted 984
3 SASI_Mm01_00158211 predicted 1086
4 SASI_Mm01_00158212 predicted 1453
5 SASI_Mm01_00158213 predicted 747
6 SASI_Mm01_00158214 predicted 1163
7 SASI_Mm01_00158215 predicted 1114
8 SASI_Mm01_00158216 predicted 1435
9 SASI_Mm01_00158217 predicted 756
10 SASI_Mm01_00158218 predicted 1781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011994
VALIDATED
ABCD2 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family D (ALD), member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011994.2-4464s1c1
Sequence:CCGGCCCACCTTACATGAAGCAATACTCGAGTATTGCTTCATGTAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011994.2-617s1c1
Sequence:CCGGCCTCGGACTTTCATCATCAAACTCGAGTTTGATGATGAAAGTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011994.2-731s1c1
Sequence:CCGGCGCTTAGTAGACCATGCCTATCTCGAGATAGGCATGGTCTACTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011994.2-1454s1c1
Sequence:CCGGGCAGGTTATACTGCTAGAGTACTCGAGTACTCTAGCAGTATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011994.2-619s1c1
Sequence:CCGGTCGGACTTTCATCATCAAATTCTCGAGAATTTGATGATGAAAGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011994.2-1254s21c1
Sequence:CCGGGGAGCAGCTGTGGACTAATTACTCGAGTAATTAGTCCACAGCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011994.2-313s21c1
Sequence:CCGGCATCATTGGCAAGCGTTTAAACTCGAGTTTAAACGCTTGCCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011994.2-760s21c1
Sequence:CCGGTTTCGCAAATCAGACTTATTACTCGAGTAATAAGTCTGATTTGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011994.2-2954s21c1
Sequence:CCGGAGCATGGCTGGACAAGTATAACTCGAGTTATACTTGTCCAGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011994.2-2265s21c1
Sequence:CCGGTGGACACTGCTATCCGTTTAACTCGAGTTAAACGGATAGCAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011994
VALIDATED
ABCD2 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family D (ALD), member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011994.2-4464s1c1
Sequence:CCGGCCCACCTTACATGAAGCAATACTCGAGTATTGCTTCATGTAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011994.2-617s1c1
Sequence:CCGGCCTCGGACTTTCATCATCAAACTCGAGTTTGATGATGAAAGTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011994.2-731s1c1
Sequence:CCGGCGCTTAGTAGACCATGCCTATCTCGAGATAGGCATGGTCTACTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011994.2-1454s1c1
Sequence:CCGGGCAGGTTATACTGCTAGAGTACTCGAGTACTCTAGCAGTATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011994.2-619s1c1
Sequence:CCGGTCGGACTTTCATCATCAAATTCTCGAGAATTTGATGATGAAAGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011994.2-1254s21c1
Sequence:CCGGGGAGCAGCTGTGGACTAATTACTCGAGTAATTAGTCCACAGCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011994.2-313s21c1
Sequence:CCGGCATCATTGGCAAGCGTTTAAACTCGAGTTTAAACGCTTGCCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011994.2-760s21c1
Sequence:CCGGTTTCGCAAATCAGACTTATTACTCGAGTAATAAGTCTGATTTGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011994.2-2954s21c1
Sequence:CCGGAGCATGGCTGGACAAGTATAACTCGAGTTATACTTGTCCAGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011994.2-2265s21c1
Sequence:CCGGTGGACACTGCTATCCGTTTAACTCGAGTTAAACGGATAGCAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011994
VALIDATED
ABCD2 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family D (ALD), member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011994.2-4464s1c1
Sequence:CCGGCCCACCTTACATGAAGCAATACTCGAGTATTGCTTCATGTAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011994.2-617s1c1
Sequence:CCGGCCTCGGACTTTCATCATCAAACTCGAGTTTGATGATGAAAGTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011994.2-731s1c1
Sequence:CCGGCGCTTAGTAGACCATGCCTATCTCGAGATAGGCATGGTCTACTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011994.2-1454s1c1
Sequence:CCGGGCAGGTTATACTGCTAGAGTACTCGAGTACTCTAGCAGTATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011994.2-619s1c1
Sequence:CCGGTCGGACTTTCATCATCAAATTCTCGAGAATTTGATGATGAAAGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011994.2-1254s21c1
Sequence:CCGGGGAGCAGCTGTGGACTAATTACTCGAGTAATTAGTCCACAGCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011994.2-313s21c1
Sequence:CCGGCATCATTGGCAAGCGTTTAAACTCGAGTTTAAACGCTTGCCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011994.2-760s21c1
Sequence:CCGGTTTCGCAAATCAGACTTATTACTCGAGTAATAAGTCTGATTTGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011994.2-2954s21c1
Sequence:CCGGAGCATGGCTGGACAAGTATAACTCGAGTTATACTTGTCCAGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011994.2-2265s21c1
Sequence:CCGGTGGACACTGCTATCCGTTTAACTCGAGTTAAACGGATAGCAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005164
ABCD2 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family D (ALD), member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-1178s1c1
Sequence:CCGGCCAATCTCTTACGGAGGATATCTCGAGATATCCTCCGTAAGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-2634s1c1
Sequence:CCGGCGTTTGACATTGAGTGAAGAACTCGAGTTCTTCACTCAATGTCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-978s1c1
Sequence:CCGGCGGACTTTCATCATCAAATTACTCGAGTAATTTGATGATGAAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-2246s1c1
Sequence:CCGGCCCTGATTCAGTGGATGATATCTCGAGATATCATCCACTGAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-1536s1c1
Sequence:CCGGGCAGATCAGATGAACCTCATTCTCGAGAATGAGGTTCATCTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005164.3-1481s21c1
Sequence:CCGGGGAGCAGCAGTGGACTAATTACTCGAGTAATTAGTCCACTGCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005164.3-1810s21c1
Sequence:CCGGAGTGACACATTGGCAATTAAACTCGAGTTTAATTGCCAATGTGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005164.3-1590s21c1
Sequence:CCGGCTTTACCACTGCTCGAAATTTCTCGAGAAATTTCGAGCAGTGGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005164.3-540s21c1
Sequence:CCGGCATCATTGGCAAGCGTTTAAACTCGAGTTTAAACGCTTGCCAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005164
ABCD2 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family D (ALD), member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-1178s1c1
Sequence:CCGGCCAATCTCTTACGGAGGATATCTCGAGATATCCTCCGTAAGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-2634s1c1
Sequence:CCGGCGTTTGACATTGAGTGAAGAACTCGAGTTCTTCACTCAATGTCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-978s1c1
Sequence:CCGGCGGACTTTCATCATCAAATTACTCGAGTAATTTGATGATGAAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-2246s1c1
Sequence:CCGGCCCTGATTCAGTGGATGATATCTCGAGATATCATCCACTGAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-1536s1c1
Sequence:CCGGGCAGATCAGATGAACCTCATTCTCGAGAATGAGGTTCATCTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005164.3-1481s21c1
Sequence:CCGGGGAGCAGCAGTGGACTAATTACTCGAGTAATTAGTCCACTGCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005164.3-1810s21c1
Sequence:CCGGAGTGACACATTGGCAATTAAACTCGAGTTTAATTGCCAATGTGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005164.3-1590s21c1
Sequence:CCGGCTTTACCACTGCTCGAAATTTCTCGAGAAATTTCGAGCAGTGGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005164.3-540s21c1
Sequence:CCGGCATCATTGGCAAGCGTTTAAACTCGAGTTTAAACGCTTGCCAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005164
ABCD2 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family D (ALD), member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-1178s1c1
Sequence:CCGGCCAATCTCTTACGGAGGATATCTCGAGATATCCTCCGTAAGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-2634s1c1
Sequence:CCGGCGTTTGACATTGAGTGAAGAACTCGAGTTCTTCACTCAATGTCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-978s1c1
Sequence:CCGGCGGACTTTCATCATCAAATTACTCGAGTAATTTGATGATGAAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-2246s1c1
Sequence:CCGGCCCTGATTCAGTGGATGATATCTCGAGATATCATCCACTGAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005164.2-1536s1c1
Sequence:CCGGGCAGATCAGATGAACCTCATTCTCGAGAATGAGGTTCATCTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005164.3-1481s21c1
Sequence:CCGGGGAGCAGCAGTGGACTAATTACTCGAGTAATTAGTCCACTGCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005164.3-1810s21c1
Sequence:CCGGAGTGACACATTGGCAATTAAACTCGAGTTTAATTGCCAATGTGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005164.3-1590s21c1
Sequence:CCGGCTTTACCACTGCTCGAAATTTCTCGAGAAATTTCGAGCAGTGGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005164.3-540s21c1
Sequence:CCGGCATCATTGGCAAGCGTTTAAACTCGAGTTTAAACGCTTGCCAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks