EMAIL THIS PAGE TO A FRIEND

ABCD3

ATP-binding cassette, sub-family D (ALD), member 3

173 Gene Product Result for
Synonyms: ABC43 PMP70 PXMP1 ZWS2
UniProtKB ID: P28288, D3DT46, Q15271, Q6NUN5, Q96DA3, Q9H529
Gene ID:
Human(5825) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein likely plays an important role in peroxisome biogenesis. Mutations have been associated with some forms of Zellweger syndrome, a heterogeneous group of peroxisome assembly disorders. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(19299) ATP-binding cassette, sub-family D (ALD), member 3
Rat(25270) ATP-binding cassette, subfamily D (ALD), member 3
sheep(101118659) ATP-binding cassette, sub-family D (ALD), member 3
Domestic Rabbit(100351172) ATP-binding cassette, sub-family D (ALD), member 3
naked mole-rat(101702609) ATP-binding cassette, sub-family D (ALD), member 3
domestic guinea pig(100725969) ATP-binding cassette, sub-family D (ALD), member 3
chicken(424487) ATP-binding cassette, sub-family D (ALD), member 3
dog(479939) ATP-binding cassette, sub-family D (ALD), member 3
domestic cat(101100069) ATP-binding cassette, sub-family D (ALD), member 3
cow(526059) ATP-binding cassette, sub-family D (ALD), member 3
Horse(100058542) ATP-binding cassette, sub-family D (ALD), member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008991 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008991 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008991 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002858 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122674 Rosetta Predictions human pricing
NM_002858 Rosetta Predictions human pricing
NM_012804 Rosetta Predictions rat pricing
NM_008991 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327196 predicted 267
2 SASI_Hs02_00327197 predicted 562
3 SASI_Hs02_00327198 predicted 494
4 SASI_Hs02_00327199 predicted 384
5 SASI_Hs02_00327200 predicted 416
6 SASI_Hs02_00327201 predicted 380
7 SASI_Hs02_00327202 predicted 447
8 SASI_Hs02_00327203 predicted 538
9 SASI_Hs02_00327204 predicted 529
10 SASI_Hs02_00327205 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334614 predicted 262
2 SASI_Hs02_00334615 predicted 557
3 SASI_Hs01_00045828 predicted 502
4 SASI_Hs01_00045830 predicted 389
5 SASI_Hs02_00334616 predicted 418
6 SASI_Hs02_00334617 predicted 382
7 SASI_Hs02_00334618 predicted 441
8 SASI_Hs02_00334619 predicted 535
9 SASI_Hs02_00334620 predicted 525
10 SASI_Hs02_00334621 predicted 378
11 SASI_Hs01_00045829 predicted 1682
12 SASI_Hs01_00045831 predicted 1210
13 SASI_Hs01_00045832 predicted 766
14 SASI_Hs01_00045833 predicted 1322
15 SASI_Hs01_00045834 predicted 1245
16 SASI_Hs01_00045835 predicted 350
17 SASI_Hs01_00045836 predicted 1758
18 SASI_Hs01_00045837 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115977 predicted 1684
2 SASI_Rn01_00115978 predicted 467
3 SASI_Rn01_00115979 predicted 433
4 SASI_Rn01_00115980 predicted 821
5 SASI_Rn02_00260241 predicted 359
6 SASI_Rn02_00260242 predicted 893
7 SASI_Rn01_00115983 predicted 1327
8 SASI_Rn01_00115984 predicted 1249
9 SASI_Rn02_00260243 predicted 514
10 SASI_Rn01_00115986 predicted 1108
11 SASI_Rn01_00115981 predicted 377
12 SASI_Rn01_00115982 predicted 1216
13 SASI_Rn01_00115985 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078025 predicted 493
2 SASI_Mm01_00078027 predicted 347
3 SASI_Mm01_00078028 predicted 874
4 SASI_Mm01_00078029 predicted 1436
5 SASI_Mm01_00078030 predicted 1194
6 SASI_Mm01_00078031 predicted 1311
7 SASI_Mm01_00078032 predicted 421
8 SASI_Mm02_00315088 predicted 1743
9 SASI_Mm01_00078033 predicted 525
10 SASI_Mm02_00315089 predicted 366
11 SASI_Mm01_00078024 predicted 388
12 SASI_Mm01_00078026 predicted 1265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008991
VALIDATED
ABCD3 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family D (ALD), member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008991.2-2388s21c1
Sequence:CCGGCCATTTGAAGTCAGCTAATTTCTCGAGAAATTAGCTGACTTCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008991.2-991s21c1
Sequence:CCGGACTGGTGGAACACCTACATAACTCGAGTTATGTAGGTGTTCCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008991.2-521s21c1
Sequence:CCGGTTCTTGAAGTATGGGTTAAATCTCGAGATTTAACCCATACTTCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008991.2-498s21c1
Sequence:CCGGCTCTTATCTCTCTGGTTAATACTCGAGTATTAACCAGAGAGATAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008991.2-597s21c1
Sequence:CCGGTCCAAGCTTTCACCTATTATACTCGAGTATAATAGGTGAAAGCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008991.2-2333s1c1
Sequence:CCGGGCCTGAATTAAATTGGGCTTACTCGAGTAAGCCCAATTTAATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008991.2-1501s1c1
Sequence:CCGGCGTTCTGATTTGTGGTCCAAACTCGAGTTTGGACCACAAATCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008991.2-846s1c1
Sequence:CCGGCCATTGGTAAGATGACAATTACTCGAGTAATTGTCATCTTACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008991.2-498s1c1
Sequence:CCGGCTCTTATCTCTCTGGTTAATACTCGAGTATTAACCAGAGAGATAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008991.2-496s1c1
Sequence:CCGGGCCTCTTATCTCTCTGGTTAACTCGAGTTAACCAGAGAGATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008991
VALIDATED
ABCD3 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family D (ALD), member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008991.2-2388s21c1
Sequence:CCGGCCATTTGAAGTCAGCTAATTTCTCGAGAAATTAGCTGACTTCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008991.2-991s21c1
Sequence:CCGGACTGGTGGAACACCTACATAACTCGAGTTATGTAGGTGTTCCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008991.2-521s21c1
Sequence:CCGGTTCTTGAAGTATGGGTTAAATCTCGAGATTTAACCCATACTTCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008991.2-498s21c1
Sequence:CCGGCTCTTATCTCTCTGGTTAATACTCGAGTATTAACCAGAGAGATAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008991.2-597s21c1
Sequence:CCGGTCCAAGCTTTCACCTATTATACTCGAGTATAATAGGTGAAAGCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008991.2-2333s1c1
Sequence:CCGGGCCTGAATTAAATTGGGCTTACTCGAGTAAGCCCAATTTAATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008991.2-1501s1c1
Sequence:CCGGCGTTCTGATTTGTGGTCCAAACTCGAGTTTGGACCACAAATCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008991.2-846s1c1
Sequence:CCGGCCATTGGTAAGATGACAATTACTCGAGTAATTGTCATCTTACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008991.2-498s1c1
Sequence:CCGGCTCTTATCTCTCTGGTTAATACTCGAGTATTAACCAGAGAGATAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008991.2-496s1c1
Sequence:CCGGGCCTCTTATCTCTCTGGTTAACTCGAGTTAACCAGAGAGATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008991
VALIDATED
ABCD3 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family D (ALD), member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008991.2-2388s21c1
Sequence:CCGGCCATTTGAAGTCAGCTAATTTCTCGAGAAATTAGCTGACTTCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008991.2-991s21c1
Sequence:CCGGACTGGTGGAACACCTACATAACTCGAGTTATGTAGGTGTTCCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008991.2-521s21c1
Sequence:CCGGTTCTTGAAGTATGGGTTAAATCTCGAGATTTAACCCATACTTCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008991.2-498s21c1
Sequence:CCGGCTCTTATCTCTCTGGTTAATACTCGAGTATTAACCAGAGAGATAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008991.2-597s21c1
Sequence:CCGGTCCAAGCTTTCACCTATTATACTCGAGTATAATAGGTGAAAGCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008991.2-2333s1c1
Sequence:CCGGGCCTGAATTAAATTGGGCTTACTCGAGTAAGCCCAATTTAATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008991.2-1501s1c1
Sequence:CCGGCGTTCTGATTTGTGGTCCAAACTCGAGTTTGGACCACAAATCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008991.2-846s1c1
Sequence:CCGGCCATTGGTAAGATGACAATTACTCGAGTAATTGTCATCTTACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008991.2-498s1c1
Sequence:CCGGCTCTTATCTCTCTGGTTAATACTCGAGTATTAACCAGAGAGATAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008991.2-496s1c1
Sequence:CCGGGCCTCTTATCTCTCTGGTTAACTCGAGTTAACCAGAGAGATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002858
VALIDATED
ABCD3 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family D (ALD), member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-232s21c1
Sequence:CCGGCCATTACAGAACAATGAGAAACTCGAGTTTCTCATTGTTCTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-1132s21c1
Sequence:CCGGCGACATCTCAAGAGTACACATCTCGAGATGTGTACTCTTGAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-357s21c1
Sequence:CCGGCTTGGTACTTATTGCTGTTATCTCGAGATAACAGCAATAAGTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-1658s21c1
Sequence:CCGGTTCGAGATCAAGTGATATATCCTCGAGGATATATCACTTGATCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-2570s21c1
Sequence:CCGGCATTGCATAACAGCGTTTATTCTCGAGAATAAACGCTGTTATGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002858.2-154s1c1
Sequence:CCGGCCATTACAGAACAATGAGAAACTCGAGTTTCTCATTGTTCTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002858.2-1451s1c1
Sequence:CCGGGCTGCGGAAAGAGTTCACTTTCTCGAGAAAGTGAACTCTTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002858.2-1054s1c1
Sequence:CCGGCGACATCTCAAGAGTACACATCTCGAGATGTGTACTCTTGAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_002858.2-985s1c1
Sequence:CCGGGCCAAATACCTTGCCACTGTTCTCGAGAACAGTGGCAAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002858.2-279s1c1
Sequence:CCGGCTTGGTACTTATTGCTGTTATCTCGAGATAACAGCAATAAGTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002858
VALIDATED
ABCD3 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family D (ALD), member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-232s21c1
Sequence:CCGGCCATTACAGAACAATGAGAAACTCGAGTTTCTCATTGTTCTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-1132s21c1
Sequence:CCGGCGACATCTCAAGAGTACACATCTCGAGATGTGTACTCTTGAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-357s21c1
Sequence:CCGGCTTGGTACTTATTGCTGTTATCTCGAGATAACAGCAATAAGTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-1658s21c1
Sequence:CCGGTTCGAGATCAAGTGATATATCCTCGAGGATATATCACTTGATCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-2570s21c1
Sequence:CCGGCATTGCATAACAGCGTTTATTCTCGAGAATAAACGCTGTTATGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002858.2-154s1c1
Sequence:CCGGCCATTACAGAACAATGAGAAACTCGAGTTTCTCATTGTTCTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002858.2-1451s1c1
Sequence:CCGGGCTGCGGAAAGAGTTCACTTTCTCGAGAAAGTGAACTCTTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002858.2-1054s1c1
Sequence:CCGGCGACATCTCAAGAGTACACATCTCGAGATGTGTACTCTTGAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_002858.2-985s1c1
Sequence:CCGGGCCAAATACCTTGCCACTGTTCTCGAGAACAGTGGCAAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002858.2-279s1c1
Sequence:CCGGCTTGGTACTTATTGCTGTTATCTCGAGATAACAGCAATAAGTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002858
VALIDATED
ABCD3 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family D (ALD), member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-232s21c1
Sequence:CCGGCCATTACAGAACAATGAGAAACTCGAGTTTCTCATTGTTCTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-1132s21c1
Sequence:CCGGCGACATCTCAAGAGTACACATCTCGAGATGTGTACTCTTGAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-357s21c1
Sequence:CCGGCTTGGTACTTATTGCTGTTATCTCGAGATAACAGCAATAAGTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-1658s21c1
Sequence:CCGGTTCGAGATCAAGTGATATATCCTCGAGGATATATCACTTGATCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002858.3-2570s21c1
Sequence:CCGGCATTGCATAACAGCGTTTATTCTCGAGAATAAACGCTGTTATGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002858.2-154s1c1
Sequence:CCGGCCATTACAGAACAATGAGAAACTCGAGTTTCTCATTGTTCTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002858.2-1451s1c1
Sequence:CCGGGCTGCGGAAAGAGTTCACTTTCTCGAGAAAGTGAACTCTTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002858.2-1054s1c1
Sequence:CCGGCGACATCTCAAGAGTACACATCTCGAGATGTGTACTCTTGAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_002858.2-985s1c1
Sequence:CCGGGCCAAATACCTTGCCACTGTTCTCGAGAACAGTGGCAAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002858.2-279s1c1
Sequence:CCGGCTTGGTACTTATTGCTGTTATCTCGAGATAACAGCAATAAGTACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks