EMAIL THIS PAGE TO A FRIEND

ABCD4

ATP-binding cassette, sub-family D (ALD), member 4

128 Gene Product Result for
Synonyms: ABC41 EST352188 MAHCJ P70R P79R PMP69 PXMP1L
UniProtKB ID: O14678, Q6IAQ0, Q96E75
Gene ID:
Human(5826) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown. However, it is speculated that it may function as a heterodimer for another peroxisomal ABC transporter and, therefore, may modify the adrenoleukodystrophy phenotype. It may also play a role in the process of peroxisome biogenesis. Alternative splicing results in at least two different transcript variants, one which is protein-coding and one which is probably not protein-coding. [provided by RefSeq, Jul 2008]
Mouse(19300) ATP-binding cassette, sub-family D (ALD), member 4
Rat(299196) ATP-binding cassette, subfamily D (ALD), member 4
Zebrafish(767748) ATP-binding cassette, sub-family D (ALD), member 4
chicken(423349) ATP-binding cassette, sub-family D (ALD), member 4
cow(528646) ATP-binding cassette, sub-family D (ALD), member 4
Horse(100056775) ATP-binding cassette, sub-family D (ALD), member 4
domestic cat(101091287) ATP-binding cassette, sub-family D (ALD), member 4
dog(490781) ATP-binding cassette, sub-family D (ALD), member 4
domestic guinea pig(100722270) ATP-binding cassette, sub-family D (ALD), member 4
naked mole-rat(101701894) ATP-binding cassette, sub-family D (ALD), member 4
sheep(101106333) ATP-binding cassette, sub-family D (ALD), member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008992 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008992 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008992 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005050 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005050 Rosetta Predictions human pricing
NM_020323 Rosetta Predictions human pricing
NM_020324 Rosetta Predictions human pricing
NM_020325 Rosetta Predictions human pricing
NM_020326 Rosetta Predictions human pricing
NR_003256 Rosetta Predictions human pricing
NM_001013100 Rosetta Predictions rat pricing
XM_001059055 Rosetta Predictions rat pricing
XM_001061210 Rosetta Predictions rat pricing
NM_008992 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338852 predicted 958
2 SASI_Hs02_00338853 predicted 369
3 SASI_Hs01_00046542 predicted 811
4 SASI_Hs02_00338854 predicted 1888
5 SASI_Hs02_00338855 predicted 590
6 SASI_Hs02_00338856 predicted 990
7 SASI_Hs02_00338857 predicted 1768
8 SASI_Hs02_00338858 predicted 1955
9 SASI_Hs02_00338859 predicted 2035
10 SASI_Hs02_00338860 predicted 879
11 SASI_Hs01_00046538 predicted 2063
12 SASI_Hs01_00046539 predicted 2130
13 SASI_Hs01_00046540 predicted 873
14 SASI_Hs01_00046541 predicted 1065
15 SASI_Hs01_00046543 predicted 1554
16 SASI_Hs01_00046544 predicted 1498
17 SASI_Hs01_00046545 predicted 1103
18 SASI_Hs01_00046546 predicted 732
19 SASI_Hs01_00046547 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063586 predicted 483
2 SASI_Hs01_00063587 predicted 483
3 SASI_Hs01_00063588 predicted 469
4 SASI_Hs01_00063589 predicted 429
5 SASI_Hs01_00063590 predicted 468
6 SASI_Hs01_00063591 predicted 1003
7 SASI_Hs01_00063592 predicted 547
8 SASI_Hs01_00063593 predicted 426
9 SASI_Hs01_00063594 predicted 427
10 SASI_Hs01_00063595 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110641 predicted 730
2 SASI_Hs01_00110642 predicted 926
3 SASI_Hs01_00110643 predicted 581
4 SASI_Hs01_00110644 predicted 1420
5 SASI_Hs01_00110645 predicted 1357
6 SASI_Hs01_00110646 predicted 957
7 SASI_Hs01_00110647 predicted 589
8 SASI_Hs01_00110648 predicted 763
9 SASI_Hs01_00110649 predicted 1194
10 SASI_Hs01_00110650 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154161 predicted 872
2 SASI_Hs01_00154162 predicted 1065
3 SASI_Hs01_00154163 predicted 722
4 SASI_Hs01_00154164 predicted 1551
5 SASI_Hs01_00154165 predicted 1504
6 SASI_Hs01_00154166 predicted 1103
7 SASI_Hs01_00154167 predicted 723
8 SASI_Hs01_00154168 predicted 906
9 SASI_Hs01_00154169 predicted 1333
10 SASI_Hs01_00154170 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038129 predicted 619
2 SASI_Hs01_00038130 predicted 610
3 SASI_Hs01_00038131 predicted 609
4 SASI_Hs01_00038132 predicted 552
5 SASI_Hs01_00038133 predicted 606
6 SASI_Hs01_00038134 predicted 1133
7 SASI_Hs01_00038135 predicted 677
8 SASI_Hs01_00038136 predicted 561
9 SASI_Hs01_00038137 predicted 565
10 SASI_Hs01_00038138 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378947 predicted 2090
2 SASI_Hs02_00378948 predicted 2300
3 SASI_Hs02_00378949 predicted 678
4 SASI_Hs02_00378950 predicted 1759
5 SASI_Hs02_00378951 predicted 467
6 SASI_Hs02_00378952 predicted 2201
7 SASI_Hs02_00378953 predicted 2174
8 SASI_Hs02_00378954 predicted 1633
9 SASI_Hs02_00378955 predicted 2296
10 SASI_Hs02_00378956 predicted 1830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200755 predicted 241
2 SASI_Rn02_00200756 predicted 370
3 SASI_Rn02_00200757 predicted 1362
4 SASI_Rn02_00200758 predicted 863
5 SASI_Rn02_00200759 predicted 1672
6 SASI_Rn02_00200760 predicted 260
7 SASI_Rn02_00200761 predicted 360
8 SASI_Rn02_00200762 predicted 282
9 SASI_Rn02_00200763 predicted 857
10 SASI_Rn02_00200764 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291768 predicted 254
2 SASI_Rn02_00291769 predicted 376
3 SASI_Rn02_00291770 predicted 1376
4 SASI_Rn02_00291771 predicted 878
5 SASI_Rn02_00291772 predicted 1682
6 SASI_Rn02_00291773 predicted 279
7 SASI_Rn02_00291774 predicted 370
8 SASI_Rn02_00291775 predicted 291
9 SASI_Rn02_00291776 predicted 860
10 SASI_Rn02_00291777 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299189 predicted 1846
2 SASI_Rn02_00299190 predicted 1068
3 SASI_Rn02_00299191 predicted 1853
4 SASI_Rn02_00299192 predicted 1790
5 SASI_Rn02_00299193 predicted 1784
6 SASI_Rn02_00299194 predicted 1680
7 SASI_Rn02_00299195 predicted 1729
8 SASI_Rn02_00299196 predicted 1068
9 SASI_Rn02_00299197 predicted 1603
10 SASI_Rn02_00299198 predicted 1770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131382 predicted 1524
2 SASI_Mm01_00131383 predicted 1959
3 SASI_Mm01_00131384 predicted 862
4 SASI_Mm01_00131385 predicted 562
5 SASI_Mm01_00131386 predicted 550
6 SASI_Mm01_00131387 predicted 1668
7 SASI_Mm01_00131389 predicted 853
8 SASI_Mm01_00131390 predicted 1251
9 SASI_Mm01_00131391 predicted 244
10 SASI_Mm02_00315090 predicted 957
11 SASI_Mm01_00131388 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008992
VALIDATED
ABCD4 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family D (ALD), member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008992.1-2057s1c1
Sequence:CCGGCCATGACTTCTTACTTCAGATCTCGAGATCTGAAGTAAGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008992.1-241s1c1
Sequence:CCGGCCAGTCAGTATTATGGAGTCTCTCGAGAGACTCCATAATACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008992.1-1849s1c1
Sequence:CCGGTGACTAGAATCAAACTGGAATCTCGAGATTCCAGTTTGATTCTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008992.1-90s1c1
Sequence:CCGGCCCAGATTAGATCTGCAACTTCTCGAGAAGTTGCAGATCTAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008992.1-609s1c1
Sequence:CCGGCCTGTGAGCATCTTTGGATATCTCGAGATATCCAAAGATGCTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008992.2-2153s21c1
Sequence:CCGGCCATGACTTCTTACTTCAGATCTCGAGATCTGAAGTAAGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008992.2-1554s21c1
Sequence:CCGGCTTCGGGAGCAGGTGATATATCTCGAGATATATCACCTGCTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008992.2-337s21c1
Sequence:CCGGCCAGTCAGTATTATGGAGTCTCTCGAGAGACTCCATAATACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008992.2-1945s21c1
Sequence:CCGGTGACTAGAATCAAACTGGAATCTCGAGATTCCAGTTTGATTCTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008992.2-625s21c1
Sequence:CCGGTGACCAGCAAGCTGATCATTTCTCGAGAAATGATCAGCTTGCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008992
VALIDATED
ABCD4 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family D (ALD), member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008992.1-2057s1c1
Sequence:CCGGCCATGACTTCTTACTTCAGATCTCGAGATCTGAAGTAAGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008992.1-241s1c1
Sequence:CCGGCCAGTCAGTATTATGGAGTCTCTCGAGAGACTCCATAATACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008992.1-1849s1c1
Sequence:CCGGTGACTAGAATCAAACTGGAATCTCGAGATTCCAGTTTGATTCTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008992.1-90s1c1
Sequence:CCGGCCCAGATTAGATCTGCAACTTCTCGAGAAGTTGCAGATCTAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008992.1-609s1c1
Sequence:CCGGCCTGTGAGCATCTTTGGATATCTCGAGATATCCAAAGATGCTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008992.2-2153s21c1
Sequence:CCGGCCATGACTTCTTACTTCAGATCTCGAGATCTGAAGTAAGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008992.2-1554s21c1
Sequence:CCGGCTTCGGGAGCAGGTGATATATCTCGAGATATATCACCTGCTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008992.2-337s21c1
Sequence:CCGGCCAGTCAGTATTATGGAGTCTCTCGAGAGACTCCATAATACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008992.2-1945s21c1
Sequence:CCGGTGACTAGAATCAAACTGGAATCTCGAGATTCCAGTTTGATTCTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008992.2-625s21c1
Sequence:CCGGTGACCAGCAAGCTGATCATTTCTCGAGAAATGATCAGCTTGCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008992
VALIDATED
ABCD4 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family D (ALD), member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008992.1-2057s1c1
Sequence:CCGGCCATGACTTCTTACTTCAGATCTCGAGATCTGAAGTAAGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008992.1-241s1c1
Sequence:CCGGCCAGTCAGTATTATGGAGTCTCTCGAGAGACTCCATAATACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008992.1-1849s1c1
Sequence:CCGGTGACTAGAATCAAACTGGAATCTCGAGATTCCAGTTTGATTCTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008992.1-90s1c1
Sequence:CCGGCCCAGATTAGATCTGCAACTTCTCGAGAAGTTGCAGATCTAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008992.1-609s1c1
Sequence:CCGGCCTGTGAGCATCTTTGGATATCTCGAGATATCCAAAGATGCTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008992.2-2153s21c1
Sequence:CCGGCCATGACTTCTTACTTCAGATCTCGAGATCTGAAGTAAGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008992.2-1554s21c1
Sequence:CCGGCTTCGGGAGCAGGTGATATATCTCGAGATATATCACCTGCTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008992.2-337s21c1
Sequence:CCGGCCAGTCAGTATTATGGAGTCTCTCGAGAGACTCCATAATACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008992.2-1945s21c1
Sequence:CCGGTGACTAGAATCAAACTGGAATCTCGAGATTCCAGTTTGATTCTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008992.2-625s21c1
Sequence:CCGGTGACCAGCAAGCTGATCATTTCTCGAGAAATGATCAGCTTGCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005050
VALIDATED
ABCD4 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family D (ALD), member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005050.1-2550s1c1
Sequence:CCGGCCCTACCTTAACCCAAATGAACTCGAGTTCATTTGGGTTAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005050.1-1794s1c1
Sequence:CCGGCCTTGAGAAGTTTCATTCCTTCTCGAGAAGGAATGAAACTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005050.1-727s1c1
Sequence:CCGGCACATGCAGATTCGGGTGAATCTCGAGATTCACCCGAATCTGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005050.1-91s1c1
Sequence:CCGGCCCAGGTTAGATCTGCAATTTCTCGAGAAATTGCAGATCTAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005050.1-867s1c1
Sequence:CCGGCGGCATCAACACCTTTGACTACTCGAGTAGTCAAAGGTGTTGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005050.3-1560s21c1
Sequence:CCGGCTTCGGGAGCAGGTGATATATCTCGAGATATATCACCTGCTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005050.3-828s21c1
Sequence:CCGGCACATGCAGATTCGGGTGAATCTCGAGATTCACCCGAATCTGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005050.3-968s21c1
Sequence:CCGGCGGCATCAACACCTTTGACTACTCGAGTAGTCAAAGGTGTTGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005050.3-2230s21c1
Sequence:CCGGCTGATTACCTACAAATGATTTCTCGAGAAATCATTTGTAGGTAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005050.3-714s21c1
Sequence:CCGGGTGAGCATCTTCGGGTATTTCCTCGAGGAAATACCCGAAGATGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005050
VALIDATED
ABCD4 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family D (ALD), member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005050.1-2550s1c1
Sequence:CCGGCCCTACCTTAACCCAAATGAACTCGAGTTCATTTGGGTTAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005050.1-1794s1c1
Sequence:CCGGCCTTGAGAAGTTTCATTCCTTCTCGAGAAGGAATGAAACTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005050.1-727s1c1
Sequence:CCGGCACATGCAGATTCGGGTGAATCTCGAGATTCACCCGAATCTGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005050.1-91s1c1
Sequence:CCGGCCCAGGTTAGATCTGCAATTTCTCGAGAAATTGCAGATCTAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005050.1-867s1c1
Sequence:CCGGCGGCATCAACACCTTTGACTACTCGAGTAGTCAAAGGTGTTGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005050.3-1560s21c1
Sequence:CCGGCTTCGGGAGCAGGTGATATATCTCGAGATATATCACCTGCTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005050.3-828s21c1
Sequence:CCGGCACATGCAGATTCGGGTGAATCTCGAGATTCACCCGAATCTGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005050.3-968s21c1
Sequence:CCGGCGGCATCAACACCTTTGACTACTCGAGTAGTCAAAGGTGTTGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005050.3-2230s21c1
Sequence:CCGGCTGATTACCTACAAATGATTTCTCGAGAAATCATTTGTAGGTAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005050.3-714s21c1
Sequence:CCGGGTGAGCATCTTCGGGTATTTCCTCGAGGAAATACCCGAAGATGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005050
VALIDATED
ABCD4 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family D (ALD), member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005050.1-2550s1c1
Sequence:CCGGCCCTACCTTAACCCAAATGAACTCGAGTTCATTTGGGTTAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005050.1-1794s1c1
Sequence:CCGGCCTTGAGAAGTTTCATTCCTTCTCGAGAAGGAATGAAACTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005050.1-727s1c1
Sequence:CCGGCACATGCAGATTCGGGTGAATCTCGAGATTCACCCGAATCTGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005050.1-91s1c1
Sequence:CCGGCCCAGGTTAGATCTGCAATTTCTCGAGAAATTGCAGATCTAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005050.1-867s1c1
Sequence:CCGGCGGCATCAACACCTTTGACTACTCGAGTAGTCAAAGGTGTTGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005050.3-1560s21c1
Sequence:CCGGCTTCGGGAGCAGGTGATATATCTCGAGATATATCACCTGCTCCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005050.3-828s21c1
Sequence:CCGGCACATGCAGATTCGGGTGAATCTCGAGATTCACCCGAATCTGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005050.3-968s21c1
Sequence:CCGGCGGCATCAACACCTTTGACTACTCGAGTAGTCAAAGGTGTTGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005050.3-2230s21c1
Sequence:CCGGCTGATTACCTACAAATGATTTCTCGAGAAATCATTTGTAGGTAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005050.3-714s21c1
Sequence:CCGGGTGAGCATCTTCGGGTATTTCCTCGAGGAAATACCCGAAGATGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks