EMAIL THIS PAGE TO A FRIEND

ABCE1

ATP-binding cassette, sub-family E (OABP), member 1

96 Gene Product Result for
Synonyms: ABC38 OABP RLI RNASEL1 RNASELI RNS4I
Gene ID:
Human(6059) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the OABP subfamily. Alternatively referred to as the RNase L inhibitor, this protein functions to block the activity of ribonuclease L. Activation of ribonuclease L leads to inhibition of protein synthesis in the 2-5A/RNase L system, the central pathway for viral interferon action. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(24015) ATP-binding cassette, sub-family E (OABP), member 1
Rat(361390) ATP-binding cassette, subfamily E (OABP), member 1
Zebrafish(406324) ATP-binding cassette, sub-family E (OABP), member 1
cow(514991) ATP-binding cassette, sub-family E (OABP), member 1
Horse(100062815) ATP-binding cassette, sub-family E (OABP), member 1
domestic cat(101086556) ATP-binding cassette, sub-family E (OABP), member 1
dog(475454) ATP-binding cassette, sub-family E (OABP), member 1
chicken(422462) ATP-binding cassette, sub-family E (OABP), member 1
sheep(101110874) ATP-binding cassette, sub-family E (OABP), member 1
Domestic Rabbit(100342820) ATP-binding cassette, sub-family E (OABP), member 1
naked mole-rat(101725149) ATP-binding cassette, sub-family E (OABP), member 1
domestic guinea pig(100728083) ATP-binding cassette, sub-family E (OABP), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015751 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015751 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015751 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002940 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040876 Rosetta Predictions human pricing
NM_002940 Rosetta Predictions human pricing
NM_001108446 Rosetta Predictions rat pricing
NM_015751 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309172 predicted 1750
2 SASI_Hs02_00309173 predicted 1540
3 SASI_Hs02_00309174 predicted 1684
4 SASI_Hs02_00309175 predicted 2161
5 SASI_Hs02_00309176 predicted 2247
6 SASI_Hs02_00309177 predicted 1898
7 SASI_Hs02_00309178 predicted 707
8 SASI_Hs02_00309179 predicted 1351
9 SASI_Hs02_00309180 predicted 1239
10 SASI_Hs02_00309181 predicted 1726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334778 predicted 1757
2 SASI_Hs01_00054655 predicted 1551
3 SASI_Hs02_00334779 predicted 1687
4 SASI_Hs01_00054657 predicted 2162
5 SASI_Hs01_00054658 predicted 2252
6 SASI_Hs02_00334780 predicted 1908
7 SASI_Hs01_00054659 predicted 708
8 SASI_Hs01_00054660 predicted 1354
9 SASI_Hs01_00054661 predicted 1242
10 SASI_Hs02_00334781 predicted 1727
11 SASI_Hs01_00054652 predicted 1122
12 SASI_Hs01_00054653 predicted 257
13 SASI_Hs01_00054654 predicted 617
14 SASI_Hs01_00054656 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108446 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238719 predicted 1003
2 SASI_Rn02_00238720 predicted 276
3 SASI_Rn02_00238721 predicted 1600
4 SASI_Rn02_00238722 predicted 1831
5 SASI_Rn02_00238723 predicted 435
6 SASI_Rn02_00238724 predicted 1851
7 SASI_Rn02_00238725 predicted 462
8 SASI_Rn02_00238726 predicted 1337
9 SASI_Rn02_00238727 predicted 274
10 SASI_Rn02_00238728 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142227 predicted 1106
2 SASI_Mm01_00142228 predicted 983
3 SASI_Mm01_00142229 predicted 951
4 SASI_Mm01_00142230 predicted 2016
5 SASI_Mm02_00323079 predicted 248
6 SASI_Mm01_00142231 predicted 1937
7 SASI_Mm01_00142232 predicted 370
8 SASI_Mm01_00142233 predicted 383
9 SASI_Mm01_00142234 predicted 1292
10 SASI_Mm01_00142235 predicted 541
11 SASI_Mm01_00142236 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015751
VALIDATED
ABCE1 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family E (OABP), member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015751.2-1437s21c1
Sequence:CCGGGCCAGTTCTAAATGTCAGTTACTCGAGTAACTGACATTTAGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015751.2-991s21c1
Sequence:CCGGGCCATTACGATTCGATCTCTACTCGAGTAGAGATCGAATCGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015751.2-3276s21c1
Sequence:CCGGGCAGGGAAATAGCAATACAAACTCGAGTTTGTATTGCTATTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015751.2-721s21c1
Sequence:CCGGGCCATTATCAAACCTCAATATCTCGAGATATTGAGGTTTGATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-3165s1c1
Sequence:CCGGGCAGGGAAATAGCAATACAAACTCGAGTTTGTATTGCTATTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-610s1c1
Sequence:CCGGGCCATTATCAAACCTCAATATCTCGAGATATTGAGGTTTGATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-1326s1c1
Sequence:CCGGGCCAGTTCTAAATGTCAGTTACTCGAGTAACTGACATTTAGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-880s1c1
Sequence:CCGGGCCATTACGATTCGATCTCTACTCGAGTAGAGATCGAATCGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-150s1c1
Sequence:CCGGCCACGACAAATGCAAACCTAACTCGAGTTAGGTTTGCATTTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015751
VALIDATED
ABCE1 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family E (OABP), member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015751.2-1437s21c1
Sequence:CCGGGCCAGTTCTAAATGTCAGTTACTCGAGTAACTGACATTTAGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015751.2-991s21c1
Sequence:CCGGGCCATTACGATTCGATCTCTACTCGAGTAGAGATCGAATCGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015751.2-3276s21c1
Sequence:CCGGGCAGGGAAATAGCAATACAAACTCGAGTTTGTATTGCTATTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015751.2-721s21c1
Sequence:CCGGGCCATTATCAAACCTCAATATCTCGAGATATTGAGGTTTGATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-3165s1c1
Sequence:CCGGGCAGGGAAATAGCAATACAAACTCGAGTTTGTATTGCTATTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-610s1c1
Sequence:CCGGGCCATTATCAAACCTCAATATCTCGAGATATTGAGGTTTGATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-1326s1c1
Sequence:CCGGGCCAGTTCTAAATGTCAGTTACTCGAGTAACTGACATTTAGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-880s1c1
Sequence:CCGGGCCATTACGATTCGATCTCTACTCGAGTAGAGATCGAATCGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-150s1c1
Sequence:CCGGCCACGACAAATGCAAACCTAACTCGAGTTAGGTTTGCATTTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015751
VALIDATED
ABCE1 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family E (OABP), member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015751.2-1437s21c1
Sequence:CCGGGCCAGTTCTAAATGTCAGTTACTCGAGTAACTGACATTTAGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015751.2-991s21c1
Sequence:CCGGGCCATTACGATTCGATCTCTACTCGAGTAGAGATCGAATCGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015751.2-3276s21c1
Sequence:CCGGGCAGGGAAATAGCAATACAAACTCGAGTTTGTATTGCTATTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015751.2-721s21c1
Sequence:CCGGGCCATTATCAAACCTCAATATCTCGAGATATTGAGGTTTGATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-3165s1c1
Sequence:CCGGGCAGGGAAATAGCAATACAAACTCGAGTTTGTATTGCTATTTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-610s1c1
Sequence:CCGGGCCATTATCAAACCTCAATATCTCGAGATATTGAGGTTTGATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-1326s1c1
Sequence:CCGGGCCAGTTCTAAATGTCAGTTACTCGAGTAACTGACATTTAGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-880s1c1
Sequence:CCGGGCCATTACGATTCGATCTCTACTCGAGTAGAGATCGAATCGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015751.1-150s1c1
Sequence:CCGGCCACGACAAATGCAAACCTAACTCGAGTTAGGTTTGCATTTGTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002940
VALIDATED
ABCE1 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family E (OABP), member 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002940.2-648s21c1
Sequence:CCGGGCCTTATCAATTGTCAATCTACTCGAGTAGATTGACAATTGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002940.2-1161s21c1
Sequence:CCGGTTTGATGAGCCTTCTAGTTACCTCGAGGTAACTAGAAGGCTCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002940.2-2678s21c1
Sequence:CCGGCCACTGATTGACATTTGATAACTCGAGTTATCAAATGTCAATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002940.2-703s21c1
Sequence:CCGGATTGTGCCAATGCCTTCAAACCTCGAGGTTTGAAGGCATTGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002940.2-1253s21c1
Sequence:CCGGTGTGGTGGAACATGATCTAAGCTCGAGCTTAGATCATGTTCCACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002940.1-867s1c1
Sequence:CCGGGCAGCGTTTAAAGGCTGCTATCTCGAGATAGCAGCCTTTAAACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002940.1-2352s1c1
Sequence:CCGGCCACTGATTGACATTTGATAACTCGAGTTATCAAATGTCAATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002940.1-322s1c1
Sequence:CCGGGCCTTATCAATTGTCAATCTACTCGAGTAGATTGACAATTGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002940.1-2570s1c1
Sequence:CCGGCCCTAACTTTACTCTGAACTTCTCGAGAAGTTCAGAGTAAAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002940.1-269s1c1
Sequence:CCGGCCGAAACTCTTTGTATTGGTTCTCGAGAACCAATACAAAGAGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002940.1-1330s1c1
Sequence:CCGGCCAGTTCTAAATGTCAGTTATCTCGAGATAACTGACATTTAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002940.1-2571s1c1
Sequence:CCGGCCTAACTTTACTCTGAACTTTCTCGAGAAAGTTCAGAGTAAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002940.1-724s1c1
Sequence:CCGGCAGCTTGATTTAACCCACCTACTCGAGTAGGTGGGTTAAATCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002940
VALIDATED
ABCE1 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family E (OABP), member 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002940.2-648s21c1
Sequence:CCGGGCCTTATCAATTGTCAATCTACTCGAGTAGATTGACAATTGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002940.2-1161s21c1
Sequence:CCGGTTTGATGAGCCTTCTAGTTACCTCGAGGTAACTAGAAGGCTCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002940.2-2678s21c1
Sequence:CCGGCCACTGATTGACATTTGATAACTCGAGTTATCAAATGTCAATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002940.2-703s21c1
Sequence:CCGGATTGTGCCAATGCCTTCAAACCTCGAGGTTTGAAGGCATTGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002940.2-1253s21c1
Sequence:CCGGTGTGGTGGAACATGATCTAAGCTCGAGCTTAGATCATGTTCCACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002940.1-867s1c1
Sequence:CCGGGCAGCGTTTAAAGGCTGCTATCTCGAGATAGCAGCCTTTAAACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002940.1-2352s1c1
Sequence:CCGGCCACTGATTGACATTTGATAACTCGAGTTATCAAATGTCAATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002940.1-322s1c1
Sequence:CCGGGCCTTATCAATTGTCAATCTACTCGAGTAGATTGACAATTGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002940.1-2570s1c1
Sequence:CCGGCCCTAACTTTACTCTGAACTTCTCGAGAAGTTCAGAGTAAAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002940.1-269s1c1
Sequence:CCGGCCGAAACTCTTTGTATTGGTTCTCGAGAACCAATACAAAGAGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002940.1-1330s1c1
Sequence:CCGGCCAGTTCTAAATGTCAGTTATCTCGAGATAACTGACATTTAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002940.1-2571s1c1
Sequence:CCGGCCTAACTTTACTCTGAACTTTCTCGAGAAAGTTCAGAGTAAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002940.1-724s1c1
Sequence:CCGGCAGCTTGATTTAACCCACCTACTCGAGTAGGTGGGTTAAATCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002940
VALIDATED
ABCE1 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family E (OABP), member 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002940.2-648s21c1
Sequence:CCGGGCCTTATCAATTGTCAATCTACTCGAGTAGATTGACAATTGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002940.2-1161s21c1
Sequence:CCGGTTTGATGAGCCTTCTAGTTACCTCGAGGTAACTAGAAGGCTCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002940.2-2678s21c1
Sequence:CCGGCCACTGATTGACATTTGATAACTCGAGTTATCAAATGTCAATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002940.2-703s21c1
Sequence:CCGGATTGTGCCAATGCCTTCAAACCTCGAGGTTTGAAGGCATTGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002940.2-1253s21c1
Sequence:CCGGTGTGGTGGAACATGATCTAAGCTCGAGCTTAGATCATGTTCCACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002940.1-867s1c1
Sequence:CCGGGCAGCGTTTAAAGGCTGCTATCTCGAGATAGCAGCCTTTAAACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002940.1-2352s1c1
Sequence:CCGGCCACTGATTGACATTTGATAACTCGAGTTATCAAATGTCAATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002940.1-322s1c1
Sequence:CCGGGCCTTATCAATTGTCAATCTACTCGAGTAGATTGACAATTGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002940.1-2570s1c1
Sequence:CCGGCCCTAACTTTACTCTGAACTTCTCGAGAAGTTCAGAGTAAAGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002940.1-269s1c1
Sequence:CCGGCCGAAACTCTTTGTATTGGTTCTCGAGAACCAATACAAAGAGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002940.1-1330s1c1
Sequence:CCGGCCAGTTCTAAATGTCAGTTATCTCGAGATAACTGACATTTAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002940.1-2571s1c1
Sequence:CCGGCCTAACTTTACTCTGAACTTTCTCGAGAAAGTTCAGAGTAAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002940.1-724s1c1
Sequence:CCGGCAGCTTGATTTAACCCACCTACTCGAGTAGGTGGGTTAAATCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks