EMAIL THIS PAGE TO A FRIEND

ABCF2

ATP-binding cassette, sub-family F (GCN20), member 2

138 Gene Product Result for
Synonyms: ABC28 EST133090 HUSSY18
UniProtKB ID: Q9UG63, O60864, Q75MJ0, Q96TE8
Gene ID:
Human(10061) Summary: This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ATP-binding casette proteins transport various molecules across extra- and intracellular membranes. Alterations in this gene may be involved in cancer progression. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been identified on chromosome 3. [provided by RefSeq, Jul 2013]
Mouse(27407) ATP-binding cassette, sub-family F (GCN20), member 2
Rat(311959) ATP-binding cassette, subfamily F (GCN20), member 2
sheep(101103804) ATP-binding cassette, sub-family F (GCN20), member 2
Domestic Rabbit(100344485) ATP-binding cassette, sub-family F (GCN20), member 2
naked mole-rat(101704867) ATP-binding cassette, sub-family F (GCN20), member 2
domestic guinea pig(100722537) ATP-binding cassette, sub-family F (GCN20), member 2
chicken(426038) ATP-binding cassette, sub-family F (GCN20), member 2
cow(513061) ATP-binding cassette, sub-family F (GCN20), member 2
domestic cat(101098857) ATP-binding cassette, sub-family F (GCN20), member 2
dog(482806) ATP-binding cassette, sub-family F (GCN20), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005692 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005692 Rosetta Predictions human pricing
NM_007189 Rosetta Predictions human pricing
NM_001109666 Rosetta Predictions rat pricing
NM_013853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013054 predicted 1597
2 SASI_Hs01_00013055 predicted 1738
3 SASI_Hs01_00013056 predicted 1013
4 SASI_Hs01_00013057 predicted 1334
5 SASI_Hs01_00013058 predicted 400
6 SASI_Hs01_00013059 predicted 539
7 SASI_Hs01_00013060 predicted 1537
8 SASI_Hs01_00013061 predicted 985
9 SASI_Hs01_00013062 predicted 1235
10 SASI_Hs01_00013063 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018524 predicted 1595
2 SASI_Hs01_00018525 predicted 1737
3 SASI_Hs01_00018526 predicted 1014
4 SASI_Hs01_00018527 predicted 1339
5 SASI_Hs01_00018528 predicted 398
6 SASI_Hs01_00018529 predicted 538
7 SASI_Hs01_00018530 predicted 1542
8 SASI_Hs01_00018531 predicted 977
9 SASI_Hs01_00018532 predicted 1235
10 SASI_Hs01_00018533 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250522 predicted 1829
2 SASI_Rn02_00250523 predicted 1438
3 SASI_Rn02_00250524 predicted 900
4 SASI_Rn02_00250525 predicted 1827
5 SASI_Rn02_00250526 predicted 1085
6 SASI_Rn02_00250527 predicted 1667
7 SASI_Rn02_00250528 predicted 1686
8 SASI_Rn02_00250529 predicted 1177
9 SASI_Rn02_00250530 predicted 1104
10 SASI_Rn02_00250531 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161892 predicted 308
2 SASI_Mm01_00161893 predicted 967
3 SASI_Mm02_00322860 predicted 781
4 SASI_Mm02_00322861 predicted 1691
5 SASI_Mm01_00161894 predicted 1291
6 SASI_Mm02_00322862 predicted 1710
7 SASI_Mm02_00322863 predicted 933
8 SASI_Mm01_00161896 predicted 1036
9 SASI_Mm02_00322864 predicted 1552
10 SASI_Mm02_00322865 predicted 987
11 SASI_Mm01_00161890 predicted 685
12 SASI_Mm01_00161891 predicted 1186
13 SASI_Mm01_00161895 predicted 974
14 SASI_Mm01_00161897 predicted 1297
15 SASI_Mm01_00161898 predicted 1304
16 SASI_Mm01_00161899 predicted 1426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005692
VALIDATED
ABCF2 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family F (GCN20), member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005692.3-1280s21c1
Sequence:CCGGAGATCCCTCCACCTGTCATTACTCGAGTAATGACAGGTGGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005692.3-1498s21c1
Sequence:CCGGGGGCGTTACCATCAGCATTTACTCGAGTAAATGCTGATGGTAACGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005692.3-2029s21c1
Sequence:CCGGCGTTTGTAAACGACGTGTTTGCTCGAGCAAACACGTCGTTTACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005692.3-1339s21c1
Sequence:CCGGCCTTGCATCTACAATAATCTACTCGAGTAGATTATTGTAGATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005692.3-448s21c1
Sequence:CCGGCGTTATGGCCTCATTGGTTTACTCGAGTAAACCAATGAGGCCATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005692.3-1117s1c1
Sequence:CCGGGCACACATGAAGAACTACATTCTCGAGAATGTAGTTCTTCATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005692.3-583s1c1
Sequence:CCGGCCCTTGCATTGTGTGATGGAACTCGAGTTCCATCACACAATGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005692.3-1573s1c1
Sequence:CCGGCCAGAGATCAAGGAGAAGGAACTCGAGTTCCTTCTCCTTGATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005692.3-1339s1c1
Sequence:CCGGCCTTGCATCTACAATAATCTACTCGAGTAGATTATTGTAGATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005692.3-837s1c1
Sequence:CCGGCCTCTTTATTCGGCCCTTCATCTCGAGATGAAGGGCCGAATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005692
VALIDATED
ABCF2 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family F (GCN20), member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005692.3-1280s21c1
Sequence:CCGGAGATCCCTCCACCTGTCATTACTCGAGTAATGACAGGTGGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005692.3-1498s21c1
Sequence:CCGGGGGCGTTACCATCAGCATTTACTCGAGTAAATGCTGATGGTAACGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005692.3-2029s21c1
Sequence:CCGGCGTTTGTAAACGACGTGTTTGCTCGAGCAAACACGTCGTTTACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005692.3-1339s21c1
Sequence:CCGGCCTTGCATCTACAATAATCTACTCGAGTAGATTATTGTAGATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005692.3-448s21c1
Sequence:CCGGCGTTATGGCCTCATTGGTTTACTCGAGTAAACCAATGAGGCCATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005692.3-1117s1c1
Sequence:CCGGGCACACATGAAGAACTACATTCTCGAGAATGTAGTTCTTCATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005692.3-583s1c1
Sequence:CCGGCCCTTGCATTGTGTGATGGAACTCGAGTTCCATCACACAATGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005692.3-1573s1c1
Sequence:CCGGCCAGAGATCAAGGAGAAGGAACTCGAGTTCCTTCTCCTTGATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005692.3-1339s1c1
Sequence:CCGGCCTTGCATCTACAATAATCTACTCGAGTAGATTATTGTAGATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005692.3-837s1c1
Sequence:CCGGCCTCTTTATTCGGCCCTTCATCTCGAGATGAAGGGCCGAATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005692
VALIDATED
ABCF2 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family F (GCN20), member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005692.3-1280s21c1
Sequence:CCGGAGATCCCTCCACCTGTCATTACTCGAGTAATGACAGGTGGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005692.3-1498s21c1
Sequence:CCGGGGGCGTTACCATCAGCATTTACTCGAGTAAATGCTGATGGTAACGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005692.3-2029s21c1
Sequence:CCGGCGTTTGTAAACGACGTGTTTGCTCGAGCAAACACGTCGTTTACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005692.3-1339s21c1
Sequence:CCGGCCTTGCATCTACAATAATCTACTCGAGTAGATTATTGTAGATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005692.3-448s21c1
Sequence:CCGGCGTTATGGCCTCATTGGTTTACTCGAGTAAACCAATGAGGCCATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005692.3-1117s1c1
Sequence:CCGGGCACACATGAAGAACTACATTCTCGAGAATGTAGTTCTTCATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005692.3-583s1c1
Sequence:CCGGCCCTTGCATTGTGTGATGGAACTCGAGTTCCATCACACAATGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_005692.3-1573s1c1
Sequence:CCGGCCAGAGATCAAGGAGAAGGAACTCGAGTTCCTTCTCCTTGATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005692.3-1339s1c1
Sequence:CCGGCCTTGCATCTACAATAATCTACTCGAGTAGATTATTGTAGATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005692.3-837s1c1
Sequence:CCGGCCTCTTTATTCGGCCCTTCATCTCGAGATGAAGGGCCGAATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013853
VALIDATED
ABCF2 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family F (GCN20), member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013853.1-2073s21c1
Sequence:CCGGCTGCCTTCGCTGCATCATATCCTCGAGGATATGATGCAGCGAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013853.1-941s21c1
Sequence:CCGGCTGTACCAATATCATCCATATCTCGAGATATGGATGATATTGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013853.1-1268s21c1
Sequence:CCGGCGTGAGCTTCAAATATACGAACTCGAGTTCGTATATTTGAAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013853.1-963s21c1
Sequence:CCGGCACAACAAGAAACTCAAGTATCTCGAGATACTTGAGTTTCTTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013853.1-373s21c1
Sequence:CCGGGCGACACCAAACTGGAATTAACTCGAGTTAATTCCAGTTTGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013853.1-2329s1c1
Sequence:CCGGCGTTCCTTATTGCTTCTGGTTCTCGAGAACCAGAAGCAATAAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013853.1-373s1c1
Sequence:CCGGGCGACACCAAACTGGAATTAACTCGAGTTAATTCCAGTTTGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013853.1-963s1c1
Sequence:CCGGCACAACAAGAAACTCAAGTATCTCGAGATACTTGAGTTTCTTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013853.1-1268s1c1
Sequence:CCGGCGTGAGCTTCAAATATACGAACTCGAGTTCGTATATTTGAAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013853.1-1292s1c1
Sequence:CCGGCGGGCCTTGCATCTACAATAACTCGAGTTATTGTAGATGCAAGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013853
VALIDATED
ABCF2 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family F (GCN20), member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013853.1-2073s21c1
Sequence:CCGGCTGCCTTCGCTGCATCATATCCTCGAGGATATGATGCAGCGAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013853.1-941s21c1
Sequence:CCGGCTGTACCAATATCATCCATATCTCGAGATATGGATGATATTGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013853.1-1268s21c1
Sequence:CCGGCGTGAGCTTCAAATATACGAACTCGAGTTCGTATATTTGAAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013853.1-963s21c1
Sequence:CCGGCACAACAAGAAACTCAAGTATCTCGAGATACTTGAGTTTCTTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013853.1-373s21c1
Sequence:CCGGGCGACACCAAACTGGAATTAACTCGAGTTAATTCCAGTTTGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013853.1-2329s1c1
Sequence:CCGGCGTTCCTTATTGCTTCTGGTTCTCGAGAACCAGAAGCAATAAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013853.1-373s1c1
Sequence:CCGGGCGACACCAAACTGGAATTAACTCGAGTTAATTCCAGTTTGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013853.1-963s1c1
Sequence:CCGGCACAACAAGAAACTCAAGTATCTCGAGATACTTGAGTTTCTTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013853.1-1268s1c1
Sequence:CCGGCGTGAGCTTCAAATATACGAACTCGAGTTCGTATATTTGAAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013853.1-1292s1c1
Sequence:CCGGCGGGCCTTGCATCTACAATAACTCGAGTTATTGTAGATGCAAGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013853
VALIDATED
ABCF2 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family F (GCN20), member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013853.1-2073s21c1
Sequence:CCGGCTGCCTTCGCTGCATCATATCCTCGAGGATATGATGCAGCGAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013853.1-941s21c1
Sequence:CCGGCTGTACCAATATCATCCATATCTCGAGATATGGATGATATTGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013853.1-1268s21c1
Sequence:CCGGCGTGAGCTTCAAATATACGAACTCGAGTTCGTATATTTGAAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013853.1-963s21c1
Sequence:CCGGCACAACAAGAAACTCAAGTATCTCGAGATACTTGAGTTTCTTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013853.1-373s21c1
Sequence:CCGGGCGACACCAAACTGGAATTAACTCGAGTTAATTCCAGTTTGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013853.1-2329s1c1
Sequence:CCGGCGTTCCTTATTGCTTCTGGTTCTCGAGAACCAGAAGCAATAAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013853.1-373s1c1
Sequence:CCGGGCGACACCAAACTGGAATTAACTCGAGTTAATTCCAGTTTGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013853.1-963s1c1
Sequence:CCGGCACAACAAGAAACTCAAGTATCTCGAGATACTTGAGTTTCTTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013853.1-1268s1c1
Sequence:CCGGCGTGAGCTTCAAATATACGAACTCGAGTTCGTATATTTGAAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013853.1-1292s1c1
Sequence:CCGGCGGGCCTTGCATCTACAATAACTCGAGTTATTGTAGATGCAAGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks