EMAIL THIS PAGE TO A FRIEND

ABCF3

ATP-binding cassette, sub-family F (GCN20), member 3

60 Gene Product Result for
Synonyms: EST201864
UniProtKB ID: Q9NUQ8, A8K241, Q86UA2, Q8NAN1, Q96GS8, Q9H7A8
Gene ID:
Mouse(27406) ATP-binding cassette, sub-family F (GCN20), member 3
Rat(287982) ATP-binding cassette, subfamily F (GCN20), member 3
chicken(424950) ATP-binding cassette, sub-family F (GCN20), member 3
dog(478651) ATP-binding cassette, sub-family F (GCN20), member 3
cow(530975) ATP-binding cassette, sub-family F (GCN20), member 3
domestic cat(101088265) ATP-binding cassette, sub-family F (GCN20), member 3
domestic guinea pig(100724507) ATP-binding cassette, sub-family F (GCN20), member 3
naked mole-rat(101715381) ATP-binding cassette, sub-family F (GCN20), member 3
sheep(101121904) ATP-binding cassette, sub-family F (GCN20), member 3
Domestic Rabbit(100350341) ATP-binding cassette, sub-family F (GCN20), member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV43684 Anti-ABCF3 antibody produced in rabbit affinity isolated antibody canine, human, bovine, mouse, guinea pig, rabbit, rat, horse
western blot pricing
HPA036332 Anti-ABCF3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2701441 Anti-ABCF3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018358 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018358 Rosetta Predictions human pricing
NM_001011896 Rosetta Predictions rat pricing
XM_573316 Rosetta Predictions rat pricing
NM_013852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230371 predicted 1166
2 SASI_Hs01_00230372 predicted 399
3 SASI_Hs01_00230373 predicted 366
4 SASI_Hs01_00230374 predicted 2100
5 SASI_Hs01_00230375 predicted 374
6 SASI_Hs01_00230376 predicted 1187
7 SASI_Hs01_00230377 predicted 1283
8 SASI_Hs01_00230378 predicted 1789
9 SASI_Hs01_00230379 predicted 1343
10 SASI_Hs02_00351820 predicted 1153
11 SASI_Hs01_00230380 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086728 predicted 1735
2 SASI_Rn01_00086731 predicted 779
3 SASI_Rn01_00086732 predicted 422
4 SASI_Rn02_00199876 predicted 287
5 SASI_Rn01_00086733 predicted 1221
6 SASI_Rn01_00086734 predicted 1283
7 SASI_Rn01_00086735 predicted 1530
8 SASI_Rn01_00086736 predicted 596
9 SASI_Rn01_00086737 predicted 1297
10 SASI_Rn02_00199877 predicted 1976
11 SASI_Rn01_00086729 predicted 1257
12 SASI_Rn01_00086730 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169054 predicted 1048
2 SASI_Rn01_00169055 predicted 2170
3 SASI_Rn01_00169056 predicted 1188
4 SASI_Rn01_00169057 predicted 1167
5 SASI_Rn01_00169058 predicted 1122
6 SASI_Rn01_00169059 predicted 1216
7 SASI_Rn01_00169060 predicted 2044
8 SASI_Rn01_00169061 predicted 504
9 SASI_Rn01_00169062 predicted 1234
10 SASI_Rn01_00169063 predicted 2207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025322 predicted 588
2 SASI_Mm01_00025323 predicted 1241
3 SASI_Mm01_00025324 predicted 762
4 SASI_Mm01_00025326 predicted 403
5 SASI_Mm01_00025327 predicted 1219
6 SASI_Mm01_00025328 predicted 597
7 SASI_Mm01_00025329 predicted 1190
8 SASI_Mm01_00025330 predicted 1428
9 SASI_Mm01_00025331 predicted 1839
10 SASI_Mm02_00322859 predicted 580
11 SASI_Mm01_00025325 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013852
ABCF3 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family F (GCN20), member 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013852.1-2249s1c1
Sequence:CCGGGACAGCCTTATTTCCCAAATTCTCGAGAATTTGGGAAATAAGGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013852.1-1071s1c1
Sequence:CCGGCCCACAAACATGCTGGATGTACTCGAGTACATCCAGCATGTTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013852.1-1362s1c1
Sequence:CCGGGCCTCTCAAGTGCAGAGTAAACTCGAGTTTACTCTGCACTTGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013852.1-1068s1c1
Sequence:CCGGGAACCCACAAACATGCTGGATCTCGAGATCCAGCATGTTTGTGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013852.1-1896s1c1
Sequence:CCGGCCCAACTTCTATATTCTGGATCTCGAGATCCAGAATATAGAAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013852.2-1955s21c1
Sequence:CCGGCCCAACTTCTATATTCTGGATCTCGAGATCCAGAATATAGAAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013852.2-1127s21c1
Sequence:CCGGGAACCCACAAACATGCTGGATCTCGAGATCCAGCATGTTTGTGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013852.2-1421s21c1
Sequence:CCGGGCCTCTCAAGTGCAGAGTAAACTCGAGTTTACTCTGCACTTGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013852.2-2308s21c1
Sequence:CCGGGACAGCCTTATTTCCCAAATTCTCGAGAATTTGGGAAATAAGGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013852
ABCF3 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family F (GCN20), member 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013852.1-2249s1c1
Sequence:CCGGGACAGCCTTATTTCCCAAATTCTCGAGAATTTGGGAAATAAGGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013852.1-1071s1c1
Sequence:CCGGCCCACAAACATGCTGGATGTACTCGAGTACATCCAGCATGTTTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013852.1-1362s1c1
Sequence:CCGGGCCTCTCAAGTGCAGAGTAAACTCGAGTTTACTCTGCACTTGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013852.1-1068s1c1
Sequence:CCGGGAACCCACAAACATGCTGGATCTCGAGATCCAGCATGTTTGTGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013852.1-1896s1c1
Sequence:CCGGCCCAACTTCTATATTCTGGATCTCGAGATCCAGAATATAGAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013852.2-1955s21c1
Sequence:CCGGCCCAACTTCTATATTCTGGATCTCGAGATCCAGAATATAGAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013852.2-1127s21c1
Sequence:CCGGGAACCCACAAACATGCTGGATCTCGAGATCCAGCATGTTTGTGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013852.2-1421s21c1
Sequence:CCGGGCCTCTCAAGTGCAGAGTAAACTCGAGTTTACTCTGCACTTGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013852.2-2308s21c1
Sequence:CCGGGACAGCCTTATTTCCCAAATTCTCGAGAATTTGGGAAATAAGGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013852
ABCF3 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family F (GCN20), member 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013852.1-2249s1c1
Sequence:CCGGGACAGCCTTATTTCCCAAATTCTCGAGAATTTGGGAAATAAGGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013852.1-1071s1c1
Sequence:CCGGCCCACAAACATGCTGGATGTACTCGAGTACATCCAGCATGTTTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013852.1-1362s1c1
Sequence:CCGGGCCTCTCAAGTGCAGAGTAAACTCGAGTTTACTCTGCACTTGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013852.1-1068s1c1
Sequence:CCGGGAACCCACAAACATGCTGGATCTCGAGATCCAGCATGTTTGTGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013852.1-1896s1c1
Sequence:CCGGCCCAACTTCTATATTCTGGATCTCGAGATCCAGAATATAGAAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013852.2-1955s21c1
Sequence:CCGGCCCAACTTCTATATTCTGGATCTCGAGATCCAGAATATAGAAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013852.2-1127s21c1
Sequence:CCGGGAACCCACAAACATGCTGGATCTCGAGATCCAGCATGTTTGTGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013852.2-1421s21c1
Sequence:CCGGGCCTCTCAAGTGCAGAGTAAACTCGAGTTTACTCTGCACTTGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013852.2-2308s21c1
Sequence:CCGGGACAGCCTTATTTCCCAAATTCTCGAGAATTTGGGAAATAAGGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018358
VALIDATED
ABCF3 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family F (GCN20), member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018358.1-452s1c1
Sequence:CCGGGTCCTCGACAGTGAATGCAAACTCGAGTTTGCATTCACTGTCGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018358.1-2382s1c1
Sequence:CCGGGAGCATCTTCTGCACAACCTTCTCGAGAAGGTTGTGCAGAAGATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018358.1-971s1c1
Sequence:CCGGGCTGGCAGAAATCTATGCCAACTCGAGTTGGCATAGATTTCTGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018358.1-2349s1c1
Sequence:CCGGCCTTATTCCCAAATGTCTCTACTCGAGTAGAGACATTTGGGAATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018358.1-386s1c1
Sequence:CCGGGTTGTCAAAGATAACGGAGAACTCGAGTTCTCCGTTATCTTTGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018358.1-639s1c1
Sequence:CCGGGATGTGCGAATTGAGAACTTTCTCGAGAAAGTTCTCAATTCGCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018358.1-378s1c1
Sequence:CCGGCCTATCCAGTTGTCAAAGATACTCGAGTATCTTTGACAACTGGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018358.1-1167s1c1
Sequence:CCGGGAACCTACAAACATGCTGGATCTCGAGATCCAGCATGTTTGTAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018358.1-2350s1c1
Sequence:CCGGCTTATTCCCAAATGTCTCTATCTCGAGATAGAGACATTTGGGAATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018358.1-1596s1c1
Sequence:CCGGGAGGTGGATTTCTACTACGATCTCGAGATCGTAGTAGAAATCCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018358
VALIDATED
ABCF3 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family F (GCN20), member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018358.1-452s1c1
Sequence:CCGGGTCCTCGACAGTGAATGCAAACTCGAGTTTGCATTCACTGTCGAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018358.1-2382s1c1
Sequence:CCGGGAGCATCTTCTGCACAACCTTCTCGAGAAGGTTGTGCAGAAGATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018358.1-971s1c1
Sequence:CCGGGCTGGCAGAAATCTATGCCAACTCGAGTTGGCATAGATTTCTGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018358.1-2349s1c1
Sequence:CCGGCCTTATTCCCAAATGTCTCTACTCGAGTAGAGACATTTGGGAATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018358.1-386s1c1
Sequence:CCGGGTTGTCAAAGATAACGGAGAACTCGAGTTCTCCGTTATCTTTGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018358.1-639s1c1
Sequence:CCGGGATGTGCGAATTGAGAACTTTCTCGAGAAAGTTCTCAATTCGCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018358.1-378s1c1
Sequence:CCGGCCTATCCAGTTGTCAAAGATACTCGAGTATCTTTGACAACTGGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018358.1-1167s1c1
Sequence:CCGGGAACCTACAAACATGCTGGATCTCGAGATCCAGCATGTTTGTAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018358.1-2350s1c1
Sequence:CCGGCTTATTCCCAAATGTCTCTATCTCGAGATAGAGACATTTGGGAATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018358.1-1596s1c1
Sequence:CCGGGAGGTGGATTTCTACTACGATCTCGAGATCGTAGTAGAAATCCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018358
VALIDATED
ABCF3 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family F (GCN20), member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018358.1-452s1c1
Sequence:CCGGGTCCTCGACAGTGAATGCAAACTCGAGTTTGCATTCACTGTCGAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018358.1-2382s1c1
Sequence:CCGGGAGCATCTTCTGCACAACCTTCTCGAGAAGGTTGTGCAGAAGATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018358.1-971s1c1
Sequence:CCGGGCTGGCAGAAATCTATGCCAACTCGAGTTGGCATAGATTTCTGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018358.1-2349s1c1
Sequence:CCGGCCTTATTCCCAAATGTCTCTACTCGAGTAGAGACATTTGGGAATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018358.1-386s1c1
Sequence:CCGGGTTGTCAAAGATAACGGAGAACTCGAGTTCTCCGTTATCTTTGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018358.1-639s1c1
Sequence:CCGGGATGTGCGAATTGAGAACTTTCTCGAGAAAGTTCTCAATTCGCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018358.1-378s1c1
Sequence:CCGGCCTATCCAGTTGTCAAAGATACTCGAGTATCTTTGACAACTGGATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018358.1-1167s1c1
Sequence:CCGGGAACCTACAAACATGCTGGATCTCGAGATCCAGCATGTTTGTAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018358.1-2350s1c1
Sequence:CCGGCTTATTCCCAAATGTCTCTATCTCGAGATAGAGACATTTGGGAATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018358.1-1596s1c1
Sequence:CCGGGAGGTGGATTTCTACTACGATCTCGAGATCGTAGTAGAAATCCACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)