EMAIL THIS PAGE TO A FRIEND

ABCG1

ATP-binding cassette, sub-family G (WHITE), member 1

128 Gene Product Result for
Synonyms: ABC8 WHITE1
Gene ID:
Human(9619) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It is involved in macrophage cholesterol and phospholipids transport, and may regulate cellular lipid homeostasis in other cell types. Six alternative splice variants have been identified. [provided by RefSeq, Jul 2008]
Mouse(11307) ATP-binding cassette, sub-family G (WHITE), member 1
Rat(85264) ATP-binding cassette, subfamily G (WHITE), member 1
sheep(101103525) ATP-binding cassette, sub-family G (WHITE), member 1
naked mole-rat(101711124) ATP-binding cassette, sub-family G (WHITE), member 1
domestic guinea pig(100721963) ATP-binding cassette, sub-family G (WHITE), member 1
Zebrafish(556979) ATP-binding cassette, sub-family G (WHITE), member 1
chicken(418533) ATP-binding cassette, sub-family G (WHITE), member 1
cow(510745) ATP-binding cassette, sub-family G (WHITE), member 1
Horse(100058103) ATP-binding cassette, sub-family G (WHITE), member 1
domestic cat(101085488) ATP-binding cassette, sub-family G (WHITE), member 1
dog(487777) ATP-binding cassette, sub-family G (WHITE), member 1
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004915 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064371 MISSION® esiRNA esiRNA human ABCG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004915 Rosetta Predictions human pricing
NM_016818 Rosetta Predictions human pricing
NM_207174 Rosetta Predictions human pricing
NM_207627 Rosetta Predictions human pricing
NM_207628 Rosetta Predictions human pricing
NM_207629 Rosetta Predictions human pricing
NM_207630 Rosetta Predictions human pricing
NM_053502 Rosetta Predictions rat pricing
NM_009593 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338579 predicted 406
2 SASI_Hs01_00057627 predicted 1981
3 SASI_Hs01_00057629 predicted 1880
4 SASI_Hs01_00057630 predicted 2048
5 SASI_Hs02_00338580 predicted 413
6 SASI_Hs01_00057632 predicted 1512
7 SASI_Hs02_00338581 predicted 385
8 SASI_Hs01_00057634 predicted 808
9 SASI_Hs01_00057635 predicted 2609
10 SASI_Hs01_00057636 predicted 1611
11 SASI_Hs01_00057628 predicted 858
12 SASI_Hs01_00057631 predicted 2152
13 SASI_Hs01_00057633 predicted 1518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349872 predicted 409
2 SASI_Hs01_00207883 predicted 1939
3 SASI_Hs01_00207885 predicted 1842
4 SASI_Hs01_00207886 predicted 2017
5 SASI_Hs02_00349873 predicted 421
6 SASI_Hs01_00207888 predicted 1473
7 SASI_Hs02_00349874 predicted 383
8 SASI_Hs01_00207890 predicted 806
9 SASI_Hs01_00207891 predicted 2576
10 SASI_Hs01_00207892 predicted 1579
11 SASI_Hs01_00207884 predicted 862
12 SASI_Hs01_00207887 predicted 2124
13 SASI_Hs01_00207889 predicted 1475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373800 predicted 407
2 SASI_Hs01_00110470 predicted 1941
3 SASI_Hs01_00110472 predicted 1846
4 SASI_Hs01_00110473 predicted 2017
5 SASI_Hs01_00110474 predicted 2115
6 SASI_Hs02_00373801 predicted 416
7 SASI_Hs01_00110475 predicted 1480
8 SASI_Hs02_00373802 predicted 390
9 SASI_Hs01_00110477 predicted 809
10 SASI_Hs01_00110478 predicted 2577
11 SASI_Hs01_00110471 predicted 861
12 SASI_Hs01_00110476 predicted 1477
13 SASI_Hs01_00110479 predicted 1586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374155 predicted 565
2 SASI_Hs01_00237166 predicted 2104
3 SASI_Hs01_00237168 predicted 2006
4 SASI_Hs01_00237169 predicted 2172
5 SASI_Hs01_00237170 predicted 2274
6 SASI_Hs02_00374156 predicted 582
7 SASI_Hs01_00237171 predicted 1632
8 SASI_Hs02_00374157 predicted 546
9 SASI_Hs01_00237173 predicted 971
10 SASI_Hs01_00237174 predicted 2739
11 SASI_Hs01_00237167 predicted 1019
12 SASI_Hs01_00237172 predicted 1642
13 SASI_Hs01_00237175 predicted 1740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374158 predicted 487
2 SASI_Hs01_00096554 predicted 2017
3 SASI_Hs01_00096556 predicted 1918
4 SASI_Hs01_00096557 predicted 2095
5 SASI_Hs02_00374159 predicted 498
6 SASI_Hs01_00096559 predicted 1548
7 SASI_Hs02_00374160 predicted 468
8 SASI_Hs01_00096561 predicted 882
9 SASI_Hs01_00096562 predicted 2651
10 SASI_Hs01_00096563 predicted 1655
11 SASI_Hs01_00096555 predicted 940
12 SASI_Hs01_00096558 predicted 2200
13 SASI_Hs01_00096560 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374161 predicted 374
2 SASI_Hs01_00011276 predicted 1908
3 SASI_Hs01_00011278 predicted 1804
4 SASI_Hs01_00011279 predicted 1977
5 SASI_Hs01_00011280 predicted 2077
6 SASI_Hs02_00374162 predicted 381
7 SASI_Hs01_00011281 predicted 1436
8 SASI_Hs02_00374163 predicted 350
9 SASI_Hs01_00011283 predicted 768
10 SASI_Hs01_00011284 predicted 2546
11 SASI_Hs01_00011277 predicted 827
12 SASI_Hs01_00011282 predicted 1438
13 SASI_Hs01_00011285 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147502 predicted 2460
2 SASI_Hs01_00147503 predicted 1343
3 SASI_Hs01_00147504 predicted 2361
4 SASI_Hs01_00147505 predicted 2541
5 SASI_Hs01_00147506 predicted 2641
6 SASI_Hs01_00147507 predicted 1995
7 SASI_Hs01_00147508 predicted 1999
8 SASI_Hs01_00147509 predicted 1290
9 SASI_Hs01_00147510 predicted 3103
10 SASI_Hs01_00147511 predicted 2098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082227 predicted 1687
2 SASI_Rn02_00266109 predicted 1036
3 SASI_Rn02_00266110 predicted 1007
4 SASI_Rn01_00082229 predicted 914
5 SASI_Rn01_00082230 predicted 1374
6 SASI_Rn01_00082231 predicted 1803
7 SASI_Rn02_00266111 predicted 419
8 SASI_Rn01_00082233 predicted 757
9 SASI_Rn01_00082234 predicted 1116
10 SASI_Rn01_00082235 predicted 1318
11 SASI_Rn01_00082228 predicted 780
12 SASI_Rn01_00082232 predicted 557
13 SASI_Rn01_00082236 predicted 1698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316507 predicted 1957
2 SASI_Mm01_00095511 predicted 1076
3 SASI_Mm01_00095512 predicted 1155
4 SASI_Mm01_00095513 predicted 1201
5 SASI_Mm01_00095514 predicted 1738
6 SASI_Mm01_00095515 predicted 959
7 SASI_Mm01_00095516 predicted 463
8 SASI_Mm01_00095517 predicted 972
9 SASI_Mm01_00095519 predicted 1017
10 SASI_Mm01_00095520 predicted 1029
11 SASI_Mm01_00095518 predicted 1385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004915
ABCG1 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family G (WHITE), member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004915.3-2351s21c1
Sequence:CCGGTAGGAAGATGTAGGCAGATTGCTCGAGCAATCTGCCTACATCTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004915.3-867s21c1
Sequence:CCGGAGGTGGTCTCGCTGATGAAAGCTCGAGCTTTCATCAGCGAGACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004915.3-436s21c1
Sequence:CCGGTGGTGAGTTGGTGGCCATTATCTCGAGATAATGGCCACCAACTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004915.3-1882s1c1
Sequence:CCGGCCTACAGTGGATGTCCTACATCTCGAGATGTAGGACATCCACTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004915.3-2057s1c1
Sequence:CCGGGACTTCATCGTACTCGGGATTCTCGAGAATCCCGAGTACGATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004915.3-1016s1c1
Sequence:CCGGCTTGTGCCATATTTGAGGGATCTCGAGATCCCTCAAATATGGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004915.3-1007s1c1
Sequence:CCGGGTCTGCAATCTTGTGCCATATCTCGAGATATGGCACAAGATTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004915.3-424s1c1
Sequence:CCGGGAAGTTCAATAGTGGTGAGTTCTCGAGAACTCACCACTATTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004915.3-2718s1c1
Sequence:CCGGGCTGAAGAATGATTCAGGGTACTCGAGTACCCTGAATCATTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004915.3-1516s1c1
Sequence:CCGGCATGCCTACTGTTCTGACATTCTCGAGAATGTCAGAACAGTAGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004915
ABCG1 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family G (WHITE), member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004915.3-2351s21c1
Sequence:CCGGTAGGAAGATGTAGGCAGATTGCTCGAGCAATCTGCCTACATCTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004915.3-867s21c1
Sequence:CCGGAGGTGGTCTCGCTGATGAAAGCTCGAGCTTTCATCAGCGAGACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004915.3-436s21c1
Sequence:CCGGTGGTGAGTTGGTGGCCATTATCTCGAGATAATGGCCACCAACTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004915.3-1882s1c1
Sequence:CCGGCCTACAGTGGATGTCCTACATCTCGAGATGTAGGACATCCACTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004915.3-2057s1c1
Sequence:CCGGGACTTCATCGTACTCGGGATTCTCGAGAATCCCGAGTACGATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004915.3-1016s1c1
Sequence:CCGGCTTGTGCCATATTTGAGGGATCTCGAGATCCCTCAAATATGGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004915.3-1007s1c1
Sequence:CCGGGTCTGCAATCTTGTGCCATATCTCGAGATATGGCACAAGATTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004915.3-424s1c1
Sequence:CCGGGAAGTTCAATAGTGGTGAGTTCTCGAGAACTCACCACTATTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004915.3-2718s1c1
Sequence:CCGGGCTGAAGAATGATTCAGGGTACTCGAGTACCCTGAATCATTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004915.3-1516s1c1
Sequence:CCGGCATGCCTACTGTTCTGACATTCTCGAGAATGTCAGAACAGTAGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004915
ABCG1 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family G (WHITE), member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004915.3-2351s21c1
Sequence:CCGGTAGGAAGATGTAGGCAGATTGCTCGAGCAATCTGCCTACATCTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004915.3-867s21c1
Sequence:CCGGAGGTGGTCTCGCTGATGAAAGCTCGAGCTTTCATCAGCGAGACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004915.3-436s21c1
Sequence:CCGGTGGTGAGTTGGTGGCCATTATCTCGAGATAATGGCCACCAACTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004915.3-1882s1c1
Sequence:CCGGCCTACAGTGGATGTCCTACATCTCGAGATGTAGGACATCCACTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004915.3-2057s1c1
Sequence:CCGGGACTTCATCGTACTCGGGATTCTCGAGAATCCCGAGTACGATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004915.3-1016s1c1
Sequence:CCGGCTTGTGCCATATTTGAGGGATCTCGAGATCCCTCAAATATGGCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004915.3-1007s1c1
Sequence:CCGGGTCTGCAATCTTGTGCCATATCTCGAGATATGGCACAAGATTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004915.3-424s1c1
Sequence:CCGGGAAGTTCAATAGTGGTGAGTTCTCGAGAACTCACCACTATTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004915.3-2718s1c1
Sequence:CCGGGCTGAAGAATGATTCAGGGTACTCGAGTACCCTGAATCATTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004915.3-1516s1c1
Sequence:CCGGCATGCCTACTGTTCTGACATTCTCGAGAATGTCAGAACAGTAGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009593
ABCG1 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family G (WHITE), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009593.1-2239s1c1
Sequence:CCGGCCGGGTTGAAACTGTTCGTTTCTCGAGAAACGAACAGTTTCAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009593.1-1687s1c1
Sequence:CCGGCCAGTCCTTAGGACTACTGATCTCGAGATCAGTAGTCCTAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009593.1-1161s1c1
Sequence:CCGGCCGATGTGAACCCGTTTCTTTCTCGAGAAAGAAACGGGTTCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009593.1-2038s1c1
Sequence:CCGGCGCCTATTTCGTCCTCAGATACTCGAGTATCTGAGGACGAAATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009593.1-1160s1c1
Sequence:CCGGACCGATGTGAACCCGTTTCTTCTCGAGAAGAAACGGGTTCACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009593
ABCG1 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family G (WHITE), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009593.1-2239s1c1
Sequence:CCGGCCGGGTTGAAACTGTTCGTTTCTCGAGAAACGAACAGTTTCAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009593.1-1687s1c1
Sequence:CCGGCCAGTCCTTAGGACTACTGATCTCGAGATCAGTAGTCCTAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009593.1-1161s1c1
Sequence:CCGGCCGATGTGAACCCGTTTCTTTCTCGAGAAAGAAACGGGTTCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009593.1-2038s1c1
Sequence:CCGGCGCCTATTTCGTCCTCAGATACTCGAGTATCTGAGGACGAAATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009593.1-1160s1c1
Sequence:CCGGACCGATGTGAACCCGTTTCTTCTCGAGAAGAAACGGGTTCACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009593
ABCG1 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family G (WHITE), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009593.1-2239s1c1
Sequence:CCGGCCGGGTTGAAACTGTTCGTTTCTCGAGAAACGAACAGTTTCAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009593.1-1687s1c1
Sequence:CCGGCCAGTCCTTAGGACTACTGATCTCGAGATCAGTAGTCCTAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009593.1-1161s1c1
Sequence:CCGGCCGATGTGAACCCGTTTCTTTCTCGAGAAAGAAACGGGTTCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009593.1-2038s1c1
Sequence:CCGGCGCCTATTTCGTCCTCAGATACTCGAGTATCTGAGGACGAAATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009593.1-1160s1c1
Sequence:CCGGACCGATGTGAACCCGTTTCTTCTCGAGAAGAAACGGGTTCACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks