EMAIL THIS PAGE TO A FRIEND

ABCG2

ATP-binding cassette, sub-family G (WHITE), member 2

113 Gene Product Result for
Synonyms: ABC15 ABCP BCRP BCRP1 BMDP CD338 CDw338 EST157481 GOUT1 MRX MXR MXR1 UAQTL1
Gene ID:
Human(9429) Summary: The membrane-associated protein encoded by this gene is included in the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. Alternatively referred to as a breast cancer resistance protein, this protein functions as a xenobiotic transporter which may play a major role in multi-drug resistance. It likely serves as a cellular defense mechanism in response to mitoxantrone and anthracycline exposure. Significant expression of this protein has been observed in the placenta, which may suggest a potential role for this molecule in placenta tissue. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(26357) ATP-binding cassette, sub-family G (WHITE), member 2
Rat(312382) ATP-binding cassette, subfamily G (WHITE), member 2
chicken(423767) ATP-binding cassette, sub-family G (WHITE), member 2
cow(536203) ATP-binding cassette, sub-family G (WHITE), member 2
Horse(100034164) ATP-binding cassette, sub-family G (WHITE), member 2
domestic cat(101094017) ATP-binding cassette, sub-family G (WHITE), member 2
dog(478472) ATP-binding cassette, sub-family G (WHITE), member 2
domestic guinea pig(100723442) ATP-binding cassette, sub-family G (WHITE), member 2
Goat(100860857) ATP-binding cassette, sub-family G (WHITE), member 2
sheep(780508) ATP-binding cassette, sub-family G (WHITE), member 2
Domestic Rabbit(100008640) ATP-binding cassette, sub-family G (WHITE), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004827 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004827 Rosetta Predictions human pricing
NM_181381 Rosetta Predictions rat pricing
NM_011920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136087 predicted 1331
2 SASI_Hs01_00136088 predicted 1177
3 SASI_Hs02_00338396 predicted 1498
4 SASI_Hs01_00136089 predicted 1457
5 SASI_Hs01_00136090 predicted 1613
6 SASI_Hs01_00136092 predicted 1209
7 SASI_Hs01_00136093 predicted 1314
8 SASI_Hs02_00338397 predicted 2291
9 SASI_Hs01_00136094 predicted 2169
10 SASI_Hs01_00136095 predicted 970
11 SASI_Hs01_00136091 predicted 1804
12 SASI_Hs01_00136096 predicted 1817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061926 predicted 915
2 SASI_Rn01_00061927 predicted 1909
3 SASI_Rn01_00061928 predicted 1268
4 SASI_Rn01_00061930 predicted 1813
5 SASI_Rn02_00269721 predicted 1533
6 SASI_Rn01_00061931 predicted 1613
7 SASI_Rn02_00269722 predicted 1130
8 SASI_Rn01_00061932 predicted 1464
9 SASI_Rn02_00269723 predicted 1166
10 SASI_Rn02_00269724 predicted 1687
11 SASI_Rn01_00061929 predicted 289
12 SASI_Rn01_00061933 predicted 555
13 SASI_Rn01_00061934 predicted 615
14 SASI_Rn01_00061935 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198628 predicted 1293
2 SASI_Mm01_00198629 predicted 578
3 SASI_Mm01_00198630 predicted 2191
4 SASI_Mm01_00198631 predicted 1334
5 SASI_Mm01_00198632 predicted 2234
6 SASI_Mm01_00198633 predicted 1544
7 SASI_Mm01_00198634 predicted 642
8 SASI_Mm01_00198635 predicted 1986
9 SASI_Mm01_00198636 predicted 1166
10 SASI_Mm01_00198637 predicted 2069
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011920
ABCG2 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family G (WHITE), member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-1185s1c1
Sequence:CCGGGCCTCGGTATTCCATCTTTAACTCGAGTTAAAGATGGAATACCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-748s1c1
Sequence:CCGGCCAAAGGGATTATCTGGAGATCTCGAGATCTCCAGATAATCCCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-2357s1c1
Sequence:CCGGCCCTGGCTTGTATGATTATTACTCGAGTAATAATCATACAAGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-1554s1c1
Sequence:CCGGGCCAGTCTATGTTACCTCTTTCTCGAGAAAGAGGTAACATAGACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-814s1c1
Sequence:CCGGTCAGGTTATGTGGTTCAAGATCTCGAGATCTTGAACCACATAACCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-814s21c1
Sequence:CCGGTCAGGTTATGTGGTTCAAGATCTCGAGATCTTGAACCACATAACCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-2357s21c1
Sequence:CCGGCCCTGGCTTGTATGATTATTACTCGAGTAATAATCATACAAGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-1185s21c1
Sequence:CCGGGCCTCGGTATTCCATCTTTAACTCGAGTTAAAGATGGAATACCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-748s21c1
Sequence:CCGGCCAAAGGGATTATCTGGAGATCTCGAGATCTCCAGATAATCCCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-1554s21c1
Sequence:CCGGGCCAGTCTATGTTACCTCTTTCTCGAGAAAGAGGTAACATAGACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011920
ABCG2 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family G (WHITE), member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-1185s1c1
Sequence:CCGGGCCTCGGTATTCCATCTTTAACTCGAGTTAAAGATGGAATACCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-748s1c1
Sequence:CCGGCCAAAGGGATTATCTGGAGATCTCGAGATCTCCAGATAATCCCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-2357s1c1
Sequence:CCGGCCCTGGCTTGTATGATTATTACTCGAGTAATAATCATACAAGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-1554s1c1
Sequence:CCGGGCCAGTCTATGTTACCTCTTTCTCGAGAAAGAGGTAACATAGACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-814s1c1
Sequence:CCGGTCAGGTTATGTGGTTCAAGATCTCGAGATCTTGAACCACATAACCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-814s21c1
Sequence:CCGGTCAGGTTATGTGGTTCAAGATCTCGAGATCTTGAACCACATAACCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-2357s21c1
Sequence:CCGGCCCTGGCTTGTATGATTATTACTCGAGTAATAATCATACAAGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-1185s21c1
Sequence:CCGGGCCTCGGTATTCCATCTTTAACTCGAGTTAAAGATGGAATACCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-748s21c1
Sequence:CCGGCCAAAGGGATTATCTGGAGATCTCGAGATCTCCAGATAATCCCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-1554s21c1
Sequence:CCGGGCCAGTCTATGTTACCTCTTTCTCGAGAAAGAGGTAACATAGACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011920
ABCG2 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family G (WHITE), member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-1185s1c1
Sequence:CCGGGCCTCGGTATTCCATCTTTAACTCGAGTTAAAGATGGAATACCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-748s1c1
Sequence:CCGGCCAAAGGGATTATCTGGAGATCTCGAGATCTCCAGATAATCCCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-2357s1c1
Sequence:CCGGCCCTGGCTTGTATGATTATTACTCGAGTAATAATCATACAAGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-1554s1c1
Sequence:CCGGGCCAGTCTATGTTACCTCTTTCTCGAGAAAGAGGTAACATAGACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011920.2-814s1c1
Sequence:CCGGTCAGGTTATGTGGTTCAAGATCTCGAGATCTTGAACCACATAACCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-814s21c1
Sequence:CCGGTCAGGTTATGTGGTTCAAGATCTCGAGATCTTGAACCACATAACCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-2357s21c1
Sequence:CCGGCCCTGGCTTGTATGATTATTACTCGAGTAATAATCATACAAGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-1185s21c1
Sequence:CCGGGCCTCGGTATTCCATCTTTAACTCGAGTTAAAGATGGAATACCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-748s21c1
Sequence:CCGGCCAAAGGGATTATCTGGAGATCTCGAGATCTCCAGATAATCCCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011920.3-1554s21c1
Sequence:CCGGGCCAGTCTATGTTACCTCTTTCTCGAGAAAGAGGTAACATAGACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004827
VALIDATED
ABCG2 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family G (WHITE), member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004827.1-936s1c1
Sequence:CCGGGCCTCGATATTCCATCTTCAACTCGAGTTGAAGATGGAATATCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004827.1-544s1c1
Sequence:CCGGCCTGCCAATTTCAAATGTAATCTCGAGATTACATTTGAAATTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004827.1-649s1c1
Sequence:CCGGGCAACAACTATGACGAATCATCTCGAGATGATTCGTCATAGTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004827.1-1718s1c1
Sequence:CCGGCCTTCTTCGTTATGATGTTTACTCGAGTAAACATCATAACGAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004827.1-1114s1c1
Sequence:CCGGGCTGTGGCATTAAACAGAGAACTCGAGTTCTCTGTTTAATGCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004827.2-2927s21c1
Sequence:CCGGGATTCTGTCTTATAGGGTAAACTCGAGTTTACCCTATAAGACAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004827.2-613s21c1
Sequence:CCGGTAACATCTGCTATCGAGTAAACTCGAGTTTACTCGATAGCAGATGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004827.2-743s21c1
Sequence:CCGGGGAGGCAAATCTTCGTTATTACTCGAGTAATAACGAAGATTTGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004827.2-1337s21c1
Sequence:CCGGTATCACTGTGAGGCCTATAATCTCGAGATTATAGGCCTCACAGTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004827.2-2647s21c1
Sequence:CCGGGACATCATGTATCGCATATTACTCGAGTAATATGCGATACATGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004827
VALIDATED
ABCG2 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family G (WHITE), member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004827.1-936s1c1
Sequence:CCGGGCCTCGATATTCCATCTTCAACTCGAGTTGAAGATGGAATATCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004827.1-544s1c1
Sequence:CCGGCCTGCCAATTTCAAATGTAATCTCGAGATTACATTTGAAATTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004827.1-649s1c1
Sequence:CCGGGCAACAACTATGACGAATCATCTCGAGATGATTCGTCATAGTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004827.1-1718s1c1
Sequence:CCGGCCTTCTTCGTTATGATGTTTACTCGAGTAAACATCATAACGAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004827.1-1114s1c1
Sequence:CCGGGCTGTGGCATTAAACAGAGAACTCGAGTTCTCTGTTTAATGCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004827.2-2927s21c1
Sequence:CCGGGATTCTGTCTTATAGGGTAAACTCGAGTTTACCCTATAAGACAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004827.2-613s21c1
Sequence:CCGGTAACATCTGCTATCGAGTAAACTCGAGTTTACTCGATAGCAGATGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004827.2-743s21c1
Sequence:CCGGGGAGGCAAATCTTCGTTATTACTCGAGTAATAACGAAGATTTGCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004827.2-1337s21c1
Sequence:CCGGTATCACTGTGAGGCCTATAATCTCGAGATTATAGGCCTCACAGTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004827.2-2647s21c1
Sequence:CCGGGACATCATGTATCGCATATTACTCGAGTAATATGCGATACATGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004827
VALIDATED
ABCG2 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family G (WHITE), member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004827.1-936s1c1
Sequence:CCGGGCCTCGATATTCCATCTTCAACTCGAGTTGAAGATGGAATATCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004827.1-544s1c1
Sequence:CCGGCCTGCCAATTTCAAATGTAATCTCGAGATTACATTTGAAATTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004827.1-649s1c1
Sequence:CCGGGCAACAACTATGACGAATCATCTCGAGATGATTCGTCATAGTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004827.1-1718s1c1
Sequence:CCGGCCTTCTTCGTTATGATGTTTACTCGAGTAAACATCATAACGAAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004827.1-1114s1c1
Sequence:CCGGGCTGTGGCATTAAACAGAGAACTCGAGTTCTCTGTTTAATGCCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004827.2-2927s21c1
Sequence:CCGGGATTCTGTCTTATAGGGTAAACTCGAGTTTACCCTATAAGACAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004827.2-613s21c1
Sequence:CCGGTAACATCTGCTATCGAGTAAACTCGAGTTTACTCGATAGCAGATGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004827.2-743s21c1
Sequence:CCGGGGAGGCAAATCTTCGTTATTACTCGAGTAATAACGAAGATTTGCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004827.2-1337s21c1
Sequence:CCGGTATCACTGTGAGGCCTATAATCTCGAGATTATAGGCCTCACAGTGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004827.2-2647s21c1
Sequence:CCGGGACATCATGTATCGCATATTACTCGAGTAATATGCGATACATGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)