EMAIL THIS PAGE TO A FRIEND

ABCG4

ATP-binding cassette, sub-family G (WHITE), member 4

199 Gene Product Result for
Synonyms: WHITE2
UniProtKB ID: Q9H172, A8K1B5
Gene ID:
Human(64137) Summary: The protein encoded by this gene is included in the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily and is expressed predominantly in liver tissue. The function has not yet been determined but may involve cholesterol transport. Alternate splice variants have been described but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
Mouse(192663) ATP-binding cassette, sub-family G (WHITE), member 4
Rat(300664) ATP-binding cassette, subfamily G (WHITE), member 4
domestic guinea pig(100719520) ATP-binding cassette, sub-family G (WHITE), member 4
naked mole-rat(101705957) ATP-binding cassette, sub-family G (WHITE), member 4
sheep(101107988) ATP-binding cassette, sub-family G (WHITE), member 4
Domestic Rabbit(100338027) ATP-binding cassette, sub-family G (WHITE), member 4
Zebrafish(564842) ATP-binding cassette, sub-family G (WHITE), member 4
chicken(428242) ATP-binding cassette, sub-family G (WHITE), member 4
dog(610604) ATP-binding cassette, sub-family G (WHITE), member 4
cow(508443) ATP-binding cassette, sub-family G (WHITE), member 4
domestic cat(101096007) ATP-binding cassette, sub-family G (WHITE), member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022169 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138955 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138955 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138955 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159961 MISSION® esiRNA esiRNA human ABCG4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022169 Rosetta Predictions human pricing
NM_001106816 Rosetta Predictions rat pricing
NM_138955 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355602 predicted 986
2 SASI_Hs01_00031340 predicted 579
3 SASI_Hs01_00031341 predicted 2058
4 SASI_Hs01_00031342 predicted 817
5 SASI_Hs01_00031344 predicted 1527
6 SASI_Hs01_00031345 predicted 1409
7 SASI_Hs01_00031346 predicted 750
8 SASI_Hs01_00031347 predicted 1023
9 SASI_Hs01_00031348 predicted 1250
10 SASI_Hs02_00355603 predicted 1943
11 SASI_Hs01_00031339 predicted 576
12 SASI_Hs01_00031343 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222688 predicted 1024
2 SASI_Rn02_00222689 predicted 1292
3 SASI_Rn02_00222690 predicted 1111
4 SASI_Rn02_00222691 predicted 1519
5 SASI_Rn02_00222692 predicted 2141
6 SASI_Rn02_00222693 predicted 802
7 SASI_Rn02_00222694 predicted 1173
8 SASI_Rn02_00222695 predicted 2025
9 SASI_Rn02_00222696 predicted 577
10 SASI_Rn02_00222697 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045334 predicted 807
2 SASI_Mm01_00045335 predicted 1971
3 SASI_Mm01_00045336 predicted 1438
4 SASI_Mm01_00045337 predicted 715
5 SASI_Mm01_00045338 predicted 1087
6 SASI_Mm01_00045339 predicted 753
7 SASI_Mm01_00045340 predicted 1623
8 SASI_Mm01_00045341 predicted 488
9 SASI_Mm01_00045342 predicted 1318
10 SASI_Mm01_00045343 predicted 1791
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022169
ABCG4 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family G (WHITE), member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-655s1c1
Sequence:CCGGCCGCCTGTCATGTTCTTTGATCTCGAGATCAAAGAACATGACAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-784s1c1
Sequence:CCGGGCCAAGCTCTTTGAGATGTTTCTCGAGAAACATCTCAAAGAGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-1078s1c1
Sequence:CCGGCCCATTGAAAGCCACACCTTTCTCGAGAAAGGTGTGGCTTTCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-118s1c1
Sequence:CCGGGTGGAGAACCACATCACTGAACTCGAGTTCAGTGATGTGGTTCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-1716s1c1
Sequence:CCGGGTATGGCTTTGAGGGTGTGATCTCGAGATCACACCCTCAAAGCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022169.4-522s21c1
Sequence:CCGGGTTCGTGGAGCTGTCCTATTCCTCGAGGAATAGGACAGCTCCACGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022169.4-2738s21c1
Sequence:CCGGGTCCACTGGAAGTCCCATTATCTCGAGATAATGGGACTTCCAGTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022169.4-1719s21c1
Sequence:CCGGGTACAGCCTCAAAGCGTATTACTCGAGTAATACGCTTTGAGGCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022169
ABCG4 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family G (WHITE), member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-655s1c1
Sequence:CCGGCCGCCTGTCATGTTCTTTGATCTCGAGATCAAAGAACATGACAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-784s1c1
Sequence:CCGGGCCAAGCTCTTTGAGATGTTTCTCGAGAAACATCTCAAAGAGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-1078s1c1
Sequence:CCGGCCCATTGAAAGCCACACCTTTCTCGAGAAAGGTGTGGCTTTCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-118s1c1
Sequence:CCGGGTGGAGAACCACATCACTGAACTCGAGTTCAGTGATGTGGTTCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-1716s1c1
Sequence:CCGGGTATGGCTTTGAGGGTGTGATCTCGAGATCACACCCTCAAAGCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022169.4-522s21c1
Sequence:CCGGGTTCGTGGAGCTGTCCTATTCCTCGAGGAATAGGACAGCTCCACGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022169.4-2738s21c1
Sequence:CCGGGTCCACTGGAAGTCCCATTATCTCGAGATAATGGGACTTCCAGTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022169.4-1719s21c1
Sequence:CCGGGTACAGCCTCAAAGCGTATTACTCGAGTAATACGCTTTGAGGCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022169
ABCG4 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family G (WHITE), member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-655s1c1
Sequence:CCGGCCGCCTGTCATGTTCTTTGATCTCGAGATCAAAGAACATGACAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-784s1c1
Sequence:CCGGGCCAAGCTCTTTGAGATGTTTCTCGAGAAACATCTCAAAGAGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-1078s1c1
Sequence:CCGGCCCATTGAAAGCCACACCTTTCTCGAGAAAGGTGTGGCTTTCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-118s1c1
Sequence:CCGGGTGGAGAACCACATCACTGAACTCGAGTTCAGTGATGTGGTTCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022169.2-1716s1c1
Sequence:CCGGGTATGGCTTTGAGGGTGTGATCTCGAGATCACACCCTCAAAGCCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022169.4-522s21c1
Sequence:CCGGGTTCGTGGAGCTGTCCTATTCCTCGAGGAATAGGACAGCTCCACGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022169.4-2738s21c1
Sequence:CCGGGTCCACTGGAAGTCCCATTATCTCGAGATAATGGGACTTCCAGTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022169.4-1719s21c1
Sequence:CCGGGTACAGCCTCAAAGCGTATTACTCGAGTAATACGCTTTGAGGCTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138955
ABCG4 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family G (WHITE), member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138955.2-2019s1c1
Sequence:CCGGGCTTAGATGAACAGTGCCCATCTCGAGATGGGCACTGTTCATCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138955.2-1981s1c1
Sequence:CCGGCCTGACCATCTATGGTATGGACTCGAGTCCATACCATAGATGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138955.2-2390s1c1
Sequence:CCGGCCCAAGTTGATGCAGTTGGTACTCGAGTACCAACTGCATCAACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138955.2-1782s1c1
Sequence:CCGGCCGCCTTAGTTGCCCAGTCTTCTCGAGAAGACTGGGCAACTAAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138955.2-661s1c1
Sequence:CCGGCCGCAAGATGTCCTGCTACATCTCGAGATGTAGCAGGACATCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138955
ABCG4 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family G (WHITE), member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138955.2-2019s1c1
Sequence:CCGGGCTTAGATGAACAGTGCCCATCTCGAGATGGGCACTGTTCATCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138955.2-1981s1c1
Sequence:CCGGCCTGACCATCTATGGTATGGACTCGAGTCCATACCATAGATGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138955.2-2390s1c1
Sequence:CCGGCCCAAGTTGATGCAGTTGGTACTCGAGTACCAACTGCATCAACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138955.2-1782s1c1
Sequence:CCGGCCGCCTTAGTTGCCCAGTCTTCTCGAGAAGACTGGGCAACTAAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138955.2-661s1c1
Sequence:CCGGCCGCAAGATGTCCTGCTACATCTCGAGATGTAGCAGGACATCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138955
ABCG4 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family G (WHITE), member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138955.2-2019s1c1
Sequence:CCGGGCTTAGATGAACAGTGCCCATCTCGAGATGGGCACTGTTCATCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138955.2-1981s1c1
Sequence:CCGGCCTGACCATCTATGGTATGGACTCGAGTCCATACCATAGATGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138955.2-2390s1c1
Sequence:CCGGCCCAAGTTGATGCAGTTGGTACTCGAGTACCAACTGCATCAACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138955.2-1782s1c1
Sequence:CCGGCCGCCTTAGTTGCCCAGTCTTCTCGAGAAGACTGGGCAACTAAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138955.2-661s1c1
Sequence:CCGGCCGCAAGATGTCCTGCTACATCTCGAGATGTAGCAGGACATCTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)