EMAIL THIS PAGE TO A FRIEND

ABCG5

ATP-binding cassette, sub-family G (WHITE), member 5

50 Gene Product Result for
Synonyms: STSL
UniProtKB ID: Q9H222
Gene ID:
Human(64240) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. The protein encoded by this gene functions as a half-transporter to limit intestinal absorption and promote biliary excretion of sterols. It is expressed in a tissue-specific manner in the liver, colon, and intestine. This gene is tandemly arrayed on chromosome 2, in a head-to-head orientation with family member ABCG8. Mutations in this gene may contribute to sterol accumulation and atheroschlerosis, and have been observed in patients with sitosterolemia. [provided by RefSeq, Jul 2008]
Mouse(27409) ATP-binding cassette, sub-family G (WHITE), member 5
Rat(114628) ATP-binding cassette, subfamily G (WHITE), member 5
Zebrafish(557317) ATP-binding cassette, sub-family G (WHITE), member 5
chicken(421401) ATP-binding cassette, sub-family G (WHITE), member 5
dog(481354) ATP-binding cassette, sub-family G (WHITE), member 5
cow(515536) ATP-binding cassette, sub-family G (WHITE), member 5
Horse(100069091) ATP-binding cassette, sub-family G (WHITE), member 5
domestic cat(101093927) ATP-binding cassette, sub-family G (WHITE), member 5
sheep(101113924) ATP-binding cassette, sub-family G (WHITE), member 5
Domestic Rabbit(100350810) ATP-binding cassette, sub-family G (WHITE), member 5
naked mole-rat(101721545) ATP-binding cassette, sub-family G (WHITE), member 5
domestic guinea pig(100725312) ATP-binding cassette, sub-family G (WHITE), member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022436 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022436 Rosetta Predictions human pricing
NM_053754 Rosetta Predictions rat pricing
NM_031884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224846 predicted 865
2 SASI_Hs01_00224847 predicted 1166
3 SASI_Hs01_00224848 predicted 1682
4 SASI_Hs01_00224849 predicted 1790
5 SASI_Hs01_00224850 predicted 1688
6 SASI_Hs01_00224852 predicted 770
7 SASI_Hs01_00224853 predicted 1558
8 SASI_Hs02_00355687 predicted 1557
9 SASI_Hs02_00355688 predicted 860
10 SASI_Hs01_00224854 predicted 1714
11 SASI_Hs01_00224845 predicted 1673
12 SASI_Hs01_00224851 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054191 predicted 1923
2 SASI_Rn01_00054192 predicted 1092
3 SASI_Rn01_00054193 predicted 1206
4 SASI_Rn01_00054194 predicted 1721
5 SASI_Rn01_00054195 predicted 609
6 SASI_Rn01_00054196 predicted 1765
7 SASI_Rn01_00054197 predicted 2016
8 SASI_Rn02_00266538 predicted 1779
9 SASI_Rn01_00054198 predicted 1829
10 SASI_Rn01_00054199 predicted 1936
11 SASI_Rn01_00054200 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119398 predicted 1526
2 SASI_Mm01_00119399 predicted 1035
3 SASI_Mm01_00119400 predicted 1163
4 SASI_Mm01_00119401 predicted 1703
5 SASI_Mm01_00119402 predicted 1915
6 SASI_Mm01_00119403 predicted 1761
7 SASI_Mm02_00337198 predicted 1338
8 SASI_Mm01_00119404 predicted 779
9 SASI_Mm01_00119405 predicted 1987
10 SASI_Mm01_00119406 predicted 1190
11 SASI_Mm01_00119397 predicted 1005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022436
ABCG5 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family G (WHITE), member 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022436.2-1855s21c1
Sequence:CCGGGTGAGATTCTTGTAGTCAATGCTCGAGCATTGACTACAAGAATCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022436.2-1399s21c1
Sequence:CCGGTAGGTCTCCTTTACCAGTTTGCTCGAGCAAACTGGTAAAGGAGACCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022436.2-1617s21c1
Sequence:CCGGCATCCTGAGGTTGCCCGATTTCTCGAGAAATCGGGCAACCTCAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-968s1c1
Sequence:CCGGGCCAGCGGAAATGCTTGATTTCTCGAGAAATCAAGCATTTCCGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-1366s1c1
Sequence:CCGGGCAATGTGCTAAAGGGTGCTACTCGAGTAGCACCCTTTAGCACATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-867s1c1
Sequence:CCGGCGAATTGTGGTTCTCACCATTCTCGAGAATGGTGAGAACCACAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-1979s1c1
Sequence:CCGGCCCAGGTGCAACATCTAGATTCTCGAGAATCTAGATGTTGCACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-1122s1c1
Sequence:CCGGGCCTACAAGAAATCAGCAATTCTCGAGAATTGCTGATTTCTTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022436
ABCG5 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family G (WHITE), member 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022436.2-1855s21c1
Sequence:CCGGGTGAGATTCTTGTAGTCAATGCTCGAGCATTGACTACAAGAATCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022436.2-1399s21c1
Sequence:CCGGTAGGTCTCCTTTACCAGTTTGCTCGAGCAAACTGGTAAAGGAGACCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022436.2-1617s21c1
Sequence:CCGGCATCCTGAGGTTGCCCGATTTCTCGAGAAATCGGGCAACCTCAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-968s1c1
Sequence:CCGGGCCAGCGGAAATGCTTGATTTCTCGAGAAATCAAGCATTTCCGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-1366s1c1
Sequence:CCGGGCAATGTGCTAAAGGGTGCTACTCGAGTAGCACCCTTTAGCACATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-867s1c1
Sequence:CCGGCGAATTGTGGTTCTCACCATTCTCGAGAATGGTGAGAACCACAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-1979s1c1
Sequence:CCGGCCCAGGTGCAACATCTAGATTCTCGAGAATCTAGATGTTGCACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-1122s1c1
Sequence:CCGGGCCTACAAGAAATCAGCAATTCTCGAGAATTGCTGATTTCTTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022436
ABCG5 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family G (WHITE), member 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022436.2-1855s21c1
Sequence:CCGGGTGAGATTCTTGTAGTCAATGCTCGAGCATTGACTACAAGAATCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022436.2-1399s21c1
Sequence:CCGGTAGGTCTCCTTTACCAGTTTGCTCGAGCAAACTGGTAAAGGAGACCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022436.2-1617s21c1
Sequence:CCGGCATCCTGAGGTTGCCCGATTTCTCGAGAAATCGGGCAACCTCAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-968s1c1
Sequence:CCGGGCCAGCGGAAATGCTTGATTTCTCGAGAAATCAAGCATTTCCGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-1366s1c1
Sequence:CCGGGCAATGTGCTAAAGGGTGCTACTCGAGTAGCACCCTTTAGCACATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-867s1c1
Sequence:CCGGCGAATTGTGGTTCTCACCATTCTCGAGAATGGTGAGAACCACAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-1979s1c1
Sequence:CCGGCCCAGGTGCAACATCTAGATTCTCGAGAATCTAGATGTTGCACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022436.2-1122s1c1
Sequence:CCGGGCCTACAAGAAATCAGCAATTCTCGAGAATTGCTGATTTCTTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031884
ABCG5 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family G (WHITE), member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031884.1-1925s1c1
Sequence:CCGGCCTCATCTTATATGGGTTTATCTCGAGATAAACCCATATAAGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031884.1-1578s1c1
Sequence:CCGGCCTCACTTAATTGGAGAATTTCTCGAGAAATTCTCCAATTAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031884.1-533s1c1
Sequence:CCGGCGCGGACTTCTACAACAAGAACTCGAGTTCTTGTTGTAGAAGTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031884.1-1172s1c1
Sequence:CCGGGCGAGTAACAAGAAACTTAATCTCGAGATTAAGTTTCTTGTTACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031884.1-2072s1c1
Sequence:CCGGACTGTCTACAACCATCAGGATCTCGAGATCCTGATGGTTGTAGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031884
ABCG5 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family G (WHITE), member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031884.1-1925s1c1
Sequence:CCGGCCTCATCTTATATGGGTTTATCTCGAGATAAACCCATATAAGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031884.1-1578s1c1
Sequence:CCGGCCTCACTTAATTGGAGAATTTCTCGAGAAATTCTCCAATTAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031884.1-533s1c1
Sequence:CCGGCGCGGACTTCTACAACAAGAACTCGAGTTCTTGTTGTAGAAGTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031884.1-1172s1c1
Sequence:CCGGGCGAGTAACAAGAAACTTAATCTCGAGATTAAGTTTCTTGTTACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031884.1-2072s1c1
Sequence:CCGGACTGTCTACAACCATCAGGATCTCGAGATCCTGATGGTTGTAGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031884
ABCG5 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family G (WHITE), member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031884.1-1925s1c1
Sequence:CCGGCCTCATCTTATATGGGTTTATCTCGAGATAAACCCATATAAGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031884.1-1578s1c1
Sequence:CCGGCCTCACTTAATTGGAGAATTTCTCGAGAAATTCTCCAATTAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031884.1-533s1c1
Sequence:CCGGCGCGGACTTCTACAACAAGAACTCGAGTTCTTGTTGTAGAAGTCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031884.1-1172s1c1
Sequence:CCGGGCGAGTAACAAGAAACTTAATCTCGAGATTAAGTTTCTTGTTACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031884.1-2072s1c1
Sequence:CCGGACTGTCTACAACCATCAGGATCTCGAGATCCTGATGGTTGTAGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)