EMAIL THIS PAGE TO A FRIEND

ABCG8

ATP-binding cassette, sub-family G (WHITE), member 8

48 Gene Product Result for
Synonyms: GBD4 STSL
UniProtKB ID: Q9H221, Q53QN8
Gene ID:
Human(64241) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. The protein encoded by this gene functions to exclude non-cholesterol sterol entry at the intestinal level, promote excretion of cholesterol and sterols into bile, and to facilitate transport of sterols back into the intestinal lumen. It is expressed in a tissue-specific manner in the liver, intestine, and gallbladder. This gene is tandemly arrayed on chromosome 2, in a head-to-head orientation with family member ABCG5. Mutations in this gene may contribute to sterol accumulation and atherosclerosis, and have been observed in patients with sitosterolemia. [provided by RefSeq, Jul 2008]
Mouse(67470) ATP-binding cassette, sub-family G (WHITE), member 8
Rat(155192) ATP-binding cassette, subfamily G (WHITE), member 8
domestic guinea pig(100725586) ATP-binding cassette, sub-family G (WHITE), member 8
naked mole-rat(101723060) ATP-binding cassette, sub-family G (WHITE), member 8
sheep(101113666) ATP-binding cassette, sub-family G (WHITE), member 8
Domestic Rabbit(100350554) ATP-binding cassette, sub-family G (WHITE), member 8
Zebrafish(100136850) ATP-binding cassette, sub-family G (WHITE), member 8
chicken(421402) ATP-binding cassette, sub-family G (WHITE), member 8
cow(508829) ATP-binding cassette, sub-family G (WHITE), member 8
Horse(100069071) ATP-binding cassette, sub-family G (WHITE), member 8
domestic cat(101099288) ATP-binding cassette, sub-family G (WHITE), member 8
dog(474571) ATP-binding cassette, sub-family G (WHITE), member 8
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026180 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026180 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026180 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022437 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038631 MISSION® esiRNA esiRNA human ABCG8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022437 Rosetta Predictions human pricing
NM_130414 Rosetta Predictions rat pricing
NM_026180 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355689 predicted 2003
2 SASI_Hs01_00184352 predicted 1543
3 SASI_Hs01_00184353 predicted 2069
4 SASI_Hs01_00184355 predicted 2087
5 SASI_Hs01_00184356 predicted 330
6 SASI_Hs01_00184357 predicted 1064
7 SASI_Hs01_00184358 predicted 772
8 SASI_Hs01_00184359 predicted 1034
9 SASI_Hs01_00184360 predicted 1148
10 SASI_Hs01_00184361 predicted 1458
11 SASI_Hs01_00184354 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044858 predicted 2031
2 SASI_Rn01_00044859 predicted 940
3 SASI_Rn02_00267410 predicted 1419
4 SASI_Rn01_00044861 predicted 196
5 SASI_Rn01_00044862 predicted 2102
6 SASI_Rn01_00044863 predicted 1853
7 SASI_Rn01_00044864 predicted 1919
8 SASI_Rn01_00044865 predicted 1929
9 SASI_Rn01_00044866 predicted 924
10 SASI_Rn02_00267411 predicted 1557
11 SASI_Rn01_00044860 predicted 2103
12 SASI_Rn01_00044867 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060667 predicted 1554
2 SASI_Mm01_00060668 predicted 1464
3 SASI_Mm01_00060669 predicted 1636
4 SASI_Mm01_00060670 predicted 935
5 SASI_Mm01_00060671 predicted 1812
6 SASI_Mm01_00060672 predicted 1930
7 SASI_Mm02_00329819 predicted 2088
8 SASI_Mm01_00060674 predicted 998
9 SASI_Mm01_00060675 predicted 800
10 SASI_Mm01_00060676 predicted 1946
11 SASI_Mm01_00060673 predicted 2012
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026180
ABCG8 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family G (WHITE), member 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026180.2-2610s1c1
Sequence:CCGGGCTGAGAGTTAATTGAGCATTCTCGAGAATGCTCAATTAACTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026180.2-2012s1c1
Sequence:CCGGGCATCCACTCTATGCGATCTACTCGAGTAGATCGCATAGAGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026180.2-924s1c1
Sequence:CCGGTCTGACATCTTCAGGCTATTTCTCGAGAAATAGCCTGAAGATGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026180.2-602s1c1
Sequence:CCGGCCTGGCTTTCATTGCCCAGATCTCGAGATCTGGGCAATGAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026180.2-2069s1c1
Sequence:CCGGCCTGTACTATCTATCCTTGAACTCGAGTTCAAGGATAGATAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026180
ABCG8 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family G (WHITE), member 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026180.2-2610s1c1
Sequence:CCGGGCTGAGAGTTAATTGAGCATTCTCGAGAATGCTCAATTAACTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026180.2-2012s1c1
Sequence:CCGGGCATCCACTCTATGCGATCTACTCGAGTAGATCGCATAGAGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026180.2-924s1c1
Sequence:CCGGTCTGACATCTTCAGGCTATTTCTCGAGAAATAGCCTGAAGATGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026180.2-602s1c1
Sequence:CCGGCCTGGCTTTCATTGCCCAGATCTCGAGATCTGGGCAATGAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026180.2-2069s1c1
Sequence:CCGGCCTGTACTATCTATCCTTGAACTCGAGTTCAAGGATAGATAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026180
ABCG8 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family G (WHITE), member 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026180.2-2610s1c1
Sequence:CCGGGCTGAGAGTTAATTGAGCATTCTCGAGAATGCTCAATTAACTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026180.2-2012s1c1
Sequence:CCGGGCATCCACTCTATGCGATCTACTCGAGTAGATCGCATAGAGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026180.2-924s1c1
Sequence:CCGGTCTGACATCTTCAGGCTATTTCTCGAGAAATAGCCTGAAGATGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026180.2-602s1c1
Sequence:CCGGCCTGGCTTTCATTGCCCAGATCTCGAGATCTGGGCAATGAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026180.2-2069s1c1
Sequence:CCGGCCTGTACTATCTATCCTTGAACTCGAGTTCAAGGATAGATAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022437
ABCG8 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family G (WHITE), member 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-1150s1c1
Sequence:CCGGCGTGACTTAGATGACTTTCTACTCGAGTAGAAAGTCATCTAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-163s1c1
Sequence:CCGGGATAGATTGTTCTCCTCTGAACTCGAGTTCAGAGGAGAACAATCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-1911s1c1
Sequence:CCGGGTTCAGCAGAAGAACTTATAACTCGAGTTATAAGTTCTTCTGCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-1368s1c1
Sequence:CCGGGATGTCAATGACCATCGGCTTCTCGAGAAGCCGATGGTCATTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-1462s1c1
Sequence:CCGGCTCATCCCTTTCAACGTCATTCTCGAGAATGACGTTGAAAGGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022437.2-1292s21c1
Sequence:CCGGCGCTGATCCGTCGTCAGATTTCTCGAGAAATCTGACGACGGATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022437.2-2359s21c1
Sequence:CCGGCACCTACAACGTTGCTAATTTCTCGAGAAATTAGCAACGTTGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022437.2-1548s21c1
Sequence:CCGGGTACACCACTGGTCCATATTTCTCGAGAAATATGGACCAGTGGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022437.2-2472s21c1
Sequence:CCGGTGGAACCTGGAGGGAACAATACTCGAGTATTGTTCCCTCCAGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022437
ABCG8 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family G (WHITE), member 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-1150s1c1
Sequence:CCGGCGTGACTTAGATGACTTTCTACTCGAGTAGAAAGTCATCTAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-163s1c1
Sequence:CCGGGATAGATTGTTCTCCTCTGAACTCGAGTTCAGAGGAGAACAATCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-1911s1c1
Sequence:CCGGGTTCAGCAGAAGAACTTATAACTCGAGTTATAAGTTCTTCTGCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-1368s1c1
Sequence:CCGGGATGTCAATGACCATCGGCTTCTCGAGAAGCCGATGGTCATTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-1462s1c1
Sequence:CCGGCTCATCCCTTTCAACGTCATTCTCGAGAATGACGTTGAAAGGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022437.2-1292s21c1
Sequence:CCGGCGCTGATCCGTCGTCAGATTTCTCGAGAAATCTGACGACGGATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022437.2-2359s21c1
Sequence:CCGGCACCTACAACGTTGCTAATTTCTCGAGAAATTAGCAACGTTGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022437.2-1548s21c1
Sequence:CCGGGTACACCACTGGTCCATATTTCTCGAGAAATATGGACCAGTGGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022437.2-2472s21c1
Sequence:CCGGTGGAACCTGGAGGGAACAATACTCGAGTATTGTTCCCTCCAGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022437
ABCG8 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family G (WHITE), member 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-1150s1c1
Sequence:CCGGCGTGACTTAGATGACTTTCTACTCGAGTAGAAAGTCATCTAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-163s1c1
Sequence:CCGGGATAGATTGTTCTCCTCTGAACTCGAGTTCAGAGGAGAACAATCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-1911s1c1
Sequence:CCGGGTTCAGCAGAAGAACTTATAACTCGAGTTATAAGTTCTTCTGCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-1368s1c1
Sequence:CCGGGATGTCAATGACCATCGGCTTCTCGAGAAGCCGATGGTCATTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022437.2-1462s1c1
Sequence:CCGGCTCATCCCTTTCAACGTCATTCTCGAGAATGACGTTGAAAGGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022437.2-1292s21c1
Sequence:CCGGCGCTGATCCGTCGTCAGATTTCTCGAGAAATCTGACGACGGATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022437.2-2359s21c1
Sequence:CCGGCACCTACAACGTTGCTAATTTCTCGAGAAATTAGCAACGTTGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022437.2-1548s21c1
Sequence:CCGGGTACACCACTGGTCCATATTTCTCGAGAAATATGGACCAGTGGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022437.2-2472s21c1
Sequence:CCGGTGGAACCTGGAGGGAACAATACTCGAGTATTGTTCCCTCCAGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks