EMAIL THIS PAGE TO A FRIEND

ABHD10

abhydrolase domain containing 10

67 Gene Product Result for
UniProtKB ID: Q9NUJ1, D3DN63, Q8TCF9
Gene ID:
Human(55347) Summary: This gene encodes a mitochondrially-localized enzyme that acts in liver cells as a hydrolase. The encoded protein removes glucuronide from mycophenolic acid acyl-glucuronide. There is a pseudogene for this gene on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Mouse(213012) abhydrolase domain containing 10
Rat(303953) abhydrolase domain containing 10
sheep(101119354) abhydrolase domain containing 10
domestic guinea pig(100733320) abhydrolase domain containing 10
naked mole-rat(101701879) abhydrolase domain containing 10
chicken(418419) abhydrolase domain containing 10
dog(478561) abhydrolase domain containing 10
cow(515563) abhydrolase domain containing 10
domestic cat(101086743) abhydrolase domain containing 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018394 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013241 MISSION® esiRNA esiRNA targeting human ABHD10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018394 Rosetta Predictions human pricing
NM_001123352 Rosetta Predictions rat pricing
NM_172511 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351886 predicted 933
2 SASI_Hs01_00199256 predicted 698
3 SASI_Hs01_00199260 predicted 512
4 SASI_Hs01_00199257 predicted 953
5 SASI_Hs01_00199258 predicted 821
6 SASI_Hs01_00199259 predicted 588
7 SASI_Hs01_00199262 predicted 966
8 SASI_Hs01_00199263 predicted 925
9 SASI_Hs01_00199264 predicted 423
10 SASI_Hs02_00351887 predicted 907
11 SASI_Hs01_00199261 predicted 480
12 SASI_Hs01_00199265 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252743 predicted 571
2 SASI_Rn02_00252744 predicted 222
3 SASI_Rn02_00252745 predicted 217
4 SASI_Rn02_00252746 predicted 367
5 SASI_Rn02_00252747 predicted 827
6 SASI_Rn02_00252748 predicted 717
7 SASI_Rn02_00252749 predicted 822
8 SASI_Rn02_00252750 predicted 630
9 SASI_Rn02_00252751 predicted 475
10 SASI_Rn02_00252752 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142685 predicted 487
2 SASI_Mm01_00142686 predicted 606
3 SASI_Mm01_00142687 predicted 466
4 SASI_Mm01_00142688 predicted 520
5 SASI_Mm02_00344107 predicted 420
6 SASI_Mm01_00142689 predicted 619
7 SASI_Mm01_00142690 predicted 487
8 SASI_Mm01_00142691 predicted 732
9 SASI_Mm01_00142692 predicted 855
10 SASI_Mm01_00142693 predicted 318
11 SASI_Mm01_00142694 predicted 879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018394
VALIDATED
ABHD10 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 10
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018394.1-910s1c1
Sequence:CCGGGCTCTCAACTATAGTTAACTACTCGAGTAGTTAACTATAGTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018394.1-253s1c1
Sequence:CCGGCCCTGGCTATCTTTCTTATATCTCGAGATATAAGAAAGATAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_018394.1-1742s1c1
Sequence:CCGGCGTTCTAAAGTCAGTAAGAAACTCGAGTTTCTTACTGACTTTAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018394.1-205s1c1
Sequence:CCGGCCTGGCTTATAAGAAGCTAAACTCGAGTTTAGCTTCTTATAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_018394.1-694s1c1
Sequence:CCGGCTGCTTGTTACATAGCCCAATCTCGAGATTGGGCTATGTAACAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018394.2-1064s21c1
Sequence:CCGGATGAAAGATCCTGATACTTTACTCGAGTAAAGTATCAGGATCTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-943s21c1
Sequence:CCGGCAACTTCTTGTTTACACTATTCTCGAGAATAGTGTAAACAAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-620s21c1
Sequence:CCGGATACCTTAGTGACAAAGTTTACTCGAGTAAACTTTGTCACTAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-516s21c1
Sequence:CCGCACAGATTCTTGTTGGATCTAGCTCGAGCTAGATCCAACAAGAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-428s21c1
Sequence:CCGGGAAGTTCAGATGGTAACTCAGCTCGAGCTGAGTTACCATCTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-853s21c1
Sequence:CCGGATGCAGGTTGCCGATCGAGTACTCGAGTACTCGATCGGCAACCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-642s21c1
Sequence:CCGGTCAGCTTCCTGTTGAGCTAAACTCGAGTTTAGCTCAACAGGAAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-396s21c1
Sequence:CCGGCGCCTGCATAAGGTTTGATTACTCGAGTAATCAAACCTTATGCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-906s21c1
Sequence:CCGGACACAGTGATCACCGAATGAGCTCGAGCTCATTCGGTGATCACTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018394.2-1281s21c1
Sequence:CCGGTAGCTATGCCAGCTCTTAATTCTCGAGAATTAAGAGCTGGCATAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-236s21c1
Sequence:CCGGAGACGTCACTCTCATTCCTTACTCGAGTAAGGAATGAGAGTGACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018394
VALIDATED
ABHD10 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 10
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018394.1-910s1c1
Sequence:CCGGGCTCTCAACTATAGTTAACTACTCGAGTAGTTAACTATAGTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018394.1-253s1c1
Sequence:CCGGCCCTGGCTATCTTTCTTATATCTCGAGATATAAGAAAGATAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_018394.1-1742s1c1
Sequence:CCGGCGTTCTAAAGTCAGTAAGAAACTCGAGTTTCTTACTGACTTTAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018394.1-205s1c1
Sequence:CCGGCCTGGCTTATAAGAAGCTAAACTCGAGTTTAGCTTCTTATAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_018394.1-694s1c1
Sequence:CCGGCTGCTTGTTACATAGCCCAATCTCGAGATTGGGCTATGTAACAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018394.2-1064s21c1
Sequence:CCGGATGAAAGATCCTGATACTTTACTCGAGTAAAGTATCAGGATCTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-943s21c1
Sequence:CCGGCAACTTCTTGTTTACACTATTCTCGAGAATAGTGTAAACAAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-620s21c1
Sequence:CCGGATACCTTAGTGACAAAGTTTACTCGAGTAAACTTTGTCACTAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-516s21c1
Sequence:CCGCACAGATTCTTGTTGGATCTAGCTCGAGCTAGATCCAACAAGAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-428s21c1
Sequence:CCGGGAAGTTCAGATGGTAACTCAGCTCGAGCTGAGTTACCATCTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-853s21c1
Sequence:CCGGATGCAGGTTGCCGATCGAGTACTCGAGTACTCGATCGGCAACCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-642s21c1
Sequence:CCGGTCAGCTTCCTGTTGAGCTAAACTCGAGTTTAGCTCAACAGGAAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-396s21c1
Sequence:CCGGCGCCTGCATAAGGTTTGATTACTCGAGTAATCAAACCTTATGCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-906s21c1
Sequence:CCGGACACAGTGATCACCGAATGAGCTCGAGCTCATTCGGTGATCACTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018394.2-1281s21c1
Sequence:CCGGTAGCTATGCCAGCTCTTAATTCTCGAGAATTAAGAGCTGGCATAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-236s21c1
Sequence:CCGGAGACGTCACTCTCATTCCTTACTCGAGTAAGGAATGAGAGTGACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018394
VALIDATED
ABHD10 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 10
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018394.1-910s1c1
Sequence:CCGGGCTCTCAACTATAGTTAACTACTCGAGTAGTTAACTATAGTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018394.1-253s1c1
Sequence:CCGGCCCTGGCTATCTTTCTTATATCTCGAGATATAAGAAAGATAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_018394.1-1742s1c1
Sequence:CCGGCGTTCTAAAGTCAGTAAGAAACTCGAGTTTCTTACTGACTTTAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018394.1-205s1c1
Sequence:CCGGCCTGGCTTATAAGAAGCTAAACTCGAGTTTAGCTTCTTATAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_018394.1-694s1c1
Sequence:CCGGCTGCTTGTTACATAGCCCAATCTCGAGATTGGGCTATGTAACAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018394.2-1064s21c1
Sequence:CCGGATGAAAGATCCTGATACTTTACTCGAGTAAAGTATCAGGATCTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-943s21c1
Sequence:CCGGCAACTTCTTGTTTACACTATTCTCGAGAATAGTGTAAACAAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-620s21c1
Sequence:CCGGATACCTTAGTGACAAAGTTTACTCGAGTAAACTTTGTCACTAAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-516s21c1
Sequence:CCGCACAGATTCTTGTTGGATCTAGCTCGAGCTAGATCCAACAAGAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-428s21c1
Sequence:CCGGGAAGTTCAGATGGTAACTCAGCTCGAGCTGAGTTACCATCTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-853s21c1
Sequence:CCGGATGCAGGTTGCCGATCGAGTACTCGAGTACTCGATCGGCAACCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-642s21c1
Sequence:CCGGTCAGCTTCCTGTTGAGCTAAACTCGAGTTTAGCTCAACAGGAAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-396s21c1
Sequence:CCGGCGCCTGCATAAGGTTTGATTACTCGAGTAATCAAACCTTATGCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-906s21c1
Sequence:CCGGACACAGTGATCACCGAATGAGCTCGAGCTCATTCGGTGATCACTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018394.2-1281s21c1
Sequence:CCGGTAGCTATGCCAGCTCTTAATTCTCGAGAATTAAGAGCTGGCATAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018394.2-236s21c1
Sequence:CCGGAGACGTCACTCTCATTCCTTACTCGAGTAAGGAATGAGAGTGACGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172511
VALIDATED
ABHD10 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172511.2-718s1c1
Sequence:CCGGCCACGGCATGAAGGATGAAATCTCGAGATTTCATCCTTCATGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172511.2-301s1c1
Sequence:CCGGCGCCTTTATAAGGTTTGACTACTCGAGTAGTCAAACCTTATAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172511.2-638s1c1
Sequence:CCGGCCGTACAGTTTCATTAAAGAACTCGAGTTCTTTAATGAAACTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172511.2-886s1c1
Sequence:CCGGGCTTTCAACTGTAGTTCCGTACTCGAGTACGGAACTACAGTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172511.2-181s1c1
Sequence:CCGGCCTGGCTTATAAGAGGTTAAACTCGAGTTTAACCTCTTATAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172511.2-886s21c1
Sequence:CCGGGCTTTCAACTGTAGTTCCGTACTCGAGTACGGAACTACAGTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172511.2-638s21c1
Sequence:CCGGCCGTACAGTTTCATTAAAGAACTCGAGTTCTTTAATGAAACTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172511.2-718s21c1
Sequence:CCGGCCACGGCATGAAGGATGAAATCTCGAGATTTCATCCTTCATGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172511.2-1370s21c1
Sequence:CCGGGTGAGGGTGCCATGCTATATTCTCGAGAATATAGCATGGCACCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172511.2-491s21c1
Sequence:CCGGGTCATAGCTCTTATTGGTATACTCGAGTATACCAATAAGAGCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172511
VALIDATED
ABHD10 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172511.2-718s1c1
Sequence:CCGGCCACGGCATGAAGGATGAAATCTCGAGATTTCATCCTTCATGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172511.2-301s1c1
Sequence:CCGGCGCCTTTATAAGGTTTGACTACTCGAGTAGTCAAACCTTATAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172511.2-638s1c1
Sequence:CCGGCCGTACAGTTTCATTAAAGAACTCGAGTTCTTTAATGAAACTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172511.2-886s1c1
Sequence:CCGGGCTTTCAACTGTAGTTCCGTACTCGAGTACGGAACTACAGTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172511.2-181s1c1
Sequence:CCGGCCTGGCTTATAAGAGGTTAAACTCGAGTTTAACCTCTTATAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172511.2-886s21c1
Sequence:CCGGGCTTTCAACTGTAGTTCCGTACTCGAGTACGGAACTACAGTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172511.2-638s21c1
Sequence:CCGGCCGTACAGTTTCATTAAAGAACTCGAGTTCTTTAATGAAACTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172511.2-718s21c1
Sequence:CCGGCCACGGCATGAAGGATGAAATCTCGAGATTTCATCCTTCATGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172511.2-1370s21c1
Sequence:CCGGGTGAGGGTGCCATGCTATATTCTCGAGAATATAGCATGGCACCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172511.2-491s21c1
Sequence:CCGGGTCATAGCTCTTATTGGTATACTCGAGTATACCAATAAGAGCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172511
VALIDATED
ABHD10 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172511.2-718s1c1
Sequence:CCGGCCACGGCATGAAGGATGAAATCTCGAGATTTCATCCTTCATGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172511.2-301s1c1
Sequence:CCGGCGCCTTTATAAGGTTTGACTACTCGAGTAGTCAAACCTTATAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172511.2-638s1c1
Sequence:CCGGCCGTACAGTTTCATTAAAGAACTCGAGTTCTTTAATGAAACTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172511.2-886s1c1
Sequence:CCGGGCTTTCAACTGTAGTTCCGTACTCGAGTACGGAACTACAGTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172511.2-181s1c1
Sequence:CCGGCCTGGCTTATAAGAGGTTAAACTCGAGTTTAACCTCTTATAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172511.2-886s21c1
Sequence:CCGGGCTTTCAACTGTAGTTCCGTACTCGAGTACGGAACTACAGTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172511.2-638s21c1
Sequence:CCGGCCGTACAGTTTCATTAAAGAACTCGAGTTCTTTAATGAAACTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172511.2-718s21c1
Sequence:CCGGCCACGGCATGAAGGATGAAATCTCGAGATTTCATCCTTCATGCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172511.2-1370s21c1
Sequence:CCGGGTGAGGGTGCCATGCTATATTCTCGAGAATATAGCATGGCACCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172511.2-491s21c1
Sequence:CCGGGTCATAGCTCTTATTGGTATACTCGAGTATACCAATAAGAGCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks