EMAIL THIS PAGE TO A FRIEND

ABHD11

abhydrolase domain containing 11

111 Gene Product Result for
Synonyms: WBSCR21
Gene ID:
Human(83451) Summary: This gene encodes a protein containing an alpha/beta hydrolase fold domain. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(68758) abhydrolase domain containing 11
Rat(360831) abhydrolase domain containing 11
Zebrafish(446169) abhydrolase domain containing 11
cow(510109) abhydrolase domain containing 11
domestic cat(101097366) abhydrolase domain containing 11
dog(489803) abhydrolase domain containing 11
chicken(417473) abhydrolase domain containing 11
naked mole-rat(101700488) abhydrolase domain containing 11
domestic guinea pig(100726390) abhydrolase domain containing 11
sheep(101112190) abhydrolase domain containing 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031295 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031295 Rosetta Predictions human pricing
NM_148912 Rosetta Predictions human pricing
NM_148913 Rosetta Predictions human pricing
NM_148914 Rosetta Predictions human pricing
NM_148915 Rosetta Predictions human pricing
NM_148916 Rosetta Predictions human pricing
XM_001077591 Rosetta Predictions rat pricing
XM_341104 Rosetta Predictions rat pricing
NM_145215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072200 predicted 486
2 SASI_Hs01_00072201 predicted 831
3 SASI_Hs01_00072202 predicted 384
4 SASI_Hs01_00072203 predicted 391
5 SASI_Hs01_00072204 predicted 774
6 SASI_Hs01_00072205 predicted 766
7 SASI_Hs01_00072206 predicted 391
8 SASI_Hs01_00072207 predicted 70
9 SASI_Hs01_00072208 predicted 699
10 SASI_Hs01_00072209 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181762 predicted 736
2 SASI_Hs02_00365643 predicted 490
3 SASI_Hs01_00181763 predicted 654
4 SASI_Hs02_00365644 predicted 392
5 SASI_Hs02_00365645 predicted 396
6 SASI_Hs02_00365646 predicted 750
7 SASI_Hs01_00181766 predicted 610
8 SASI_Hs01_00181767 predicted 596
9 SASI_Hs01_00181768 predicted 568
10 SASI_Hs01_00181769 predicted 715
11 SASI_Hs01_00181764 predicted 660
12 SASI_Hs01_00181765 predicted 574
13 SASI_Hs01_00181770 predicted 551
14 SASI_Hs01_00181771 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038925 predicted 723
2 SASI_Hs01_00038926 predicted 469
3 SASI_Hs01_00038927 predicted 645
4 SASI_Hs01_00038928 predicted 642
5 SASI_Hs01_00038929 predicted 559
6 SASI_Hs01_00038930 predicted 598
7 SASI_Hs01_00038931 predicted 580
8 SASI_Hs01_00038932 predicted 556
9 SASI_Hs01_00038933 predicted 695
10 SASI_Hs01_00038934 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122080 predicted 252
2 SASI_Hs01_00122081 predicted 255
3 SASI_Hs01_00122082 predicted 273
4 SASI_Hs01_00122083 predicted 292
5 SASI_Hs01_00122084 predicted 251
6 SASI_Hs01_00122085 predicted 291
7 SASI_Hs01_00122086 predicted 451
8 SASI_Hs01_00122087 predicted 313
9 SASI_Hs01_00122088 predicted 376
10 SASI_Hs01_00122089 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238195 predicted 739
2 SASI_Hs01_00238196 predicted 734
3 SASI_Hs01_00238197 predicted 764
4 SASI_Hs01_00238198 predicted 734
5 SASI_Hs01_00238199 predicted 771
6 SASI_Hs01_00238200 predicted 762
7 SASI_Hs01_00238201 predicted 766
8 SASI_Hs01_00238202 predicted 786
9 SASI_Hs01_00238203 predicted 781
10 SASI_Hs01_00238204 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021574 predicted 528
2 SASI_Hs01_00021575 predicted 212
3 SASI_Hs01_00021576 predicted 462
4 SASI_Hs01_00021577 predicted 280
5 SASI_Hs01_00021578 predicted 66
6 SASI_Hs01_00021579 predicted 272
7 SASI_Hs01_00021580 predicted 69
8 SASI_Hs01_00021581 predicted 459
9 SASI_Hs01_00021582 predicted 459
10 SASI_Hs01_00021583 predicted 106
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357671 predicted 622
2 SASI_Rn02_00357672 predicted 532
3 SASI_Rn02_00357673 predicted 451
4 SASI_Rn02_00357674 predicted 705
5 SASI_Rn02_00357675 predicted 342
6 SASI_Rn02_00357676 predicted 655
7 SASI_Rn02_00357677 predicted 562
8 SASI_Rn02_00357678 predicted 306
9 SASI_Rn02_00357679 predicted 522
10 SASI_Rn02_00357680 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392361 predicted 449
2 SASI_Rn02_00392362 predicted 875
3 SASI_Rn02_00392363 predicted 705
4 SASI_Rn02_00392364 predicted 561
5 SASI_Rn02_00392365 predicted 754
6 SASI_Rn02_00392366 predicted 555
7 SASI_Rn02_00392367 predicted 521
8 SASI_Rn02_00392368 predicted 476
9 SASI_Rn02_00392369 predicted 232
10 SASI_Rn02_00392370 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165535 predicted 845
2 SASI_Mm01_00165536 predicted 1172
3 SASI_Mm01_00165537 predicted 859
4 SASI_Mm01_00165538 predicted 857
5 SASI_Mm01_00165539 predicted 1174
6 SASI_Mm01_00165540 predicted 723
7 SASI_Mm02_00340589 predicted 1128
8 SASI_Mm01_00165541 predicted 842
9 SASI_Mm01_00165542 predicted 1056
10 SASI_Mm01_00165543 predicted 1210
11 SASI_Mm01_00165534 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145215
ABHD11 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-1001s1c1
Sequence:CCGGGCAGCTTAGTTCGGTTGTCAACTCGAGTTGACAACCGAACTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-867s1c1
Sequence:CCGGCGATTGGTTGTTGTAGACATACTCGAGTATGTCTACAACAACCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-549s1c1
Sequence:CCGGCCGCTGTCTTATAATCTTCTACTCGAGTAGAAGATTATAAGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-1086s1c1
Sequence:CCGGAGACTGAACTTGGATACGTTACTCGAGTAACGTATCCAAGTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-1178s1c1
Sequence:CCGGGCTTGGTGGAAATTCTACATACTCGAGTATGTAGAATTTCCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145215
ABHD11 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-1001s1c1
Sequence:CCGGGCAGCTTAGTTCGGTTGTCAACTCGAGTTGACAACCGAACTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-867s1c1
Sequence:CCGGCGATTGGTTGTTGTAGACATACTCGAGTATGTCTACAACAACCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-549s1c1
Sequence:CCGGCCGCTGTCTTATAATCTTCTACTCGAGTAGAAGATTATAAGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-1086s1c1
Sequence:CCGGAGACTGAACTTGGATACGTTACTCGAGTAACGTATCCAAGTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-1178s1c1
Sequence:CCGGGCTTGGTGGAAATTCTACATACTCGAGTATGTAGAATTTCCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145215
ABHD11 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-1001s1c1
Sequence:CCGGGCAGCTTAGTTCGGTTGTCAACTCGAGTTGACAACCGAACTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-867s1c1
Sequence:CCGGCGATTGGTTGTTGTAGACATACTCGAGTATGTCTACAACAACCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-549s1c1
Sequence:CCGGCCGCTGTCTTATAATCTTCTACTCGAGTAGAAGATTATAAGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-1086s1c1
Sequence:CCGGAGACTGAACTTGGATACGTTACTCGAGTAACGTATCCAAGTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145215.1-1178s1c1
Sequence:CCGGGCTTGGTGGAAATTCTACATACTCGAGTATGTAGAATTTCCACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031295
ABHD11 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 11
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000050728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031295.2-305s1c1
Sequence:CCGGCTTCAACTCCATCGCCAAGATCTCGAGATCTTGGCGATGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031295.2-279s1c1
Sequence:CCGGCACGGGCTCTTCGGCAGCAAACTCGAGTTTGCTGCCGAAGAGCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031295.2-211s1c1
Sequence:CCGGCGAGGCCGCTTCCGCTTTCCTCTCGAGAGGAAAGCGGAAGCGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031295.2-340s1c1
Sequence:CCGGCAGGCCGTGCTGACGGTGGATCTCGAGATCCACCGTCAGCACGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031295
ABHD11 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 11
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000050728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031295.2-305s1c1
Sequence:CCGGCTTCAACTCCATCGCCAAGATCTCGAGATCTTGGCGATGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031295.2-279s1c1
Sequence:CCGGCACGGGCTCTTCGGCAGCAAACTCGAGTTTGCTGCCGAAGAGCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031295.2-211s1c1
Sequence:CCGGCGAGGCCGCTTCCGCTTTCCTCTCGAGAGGAAAGCGGAAGCGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031295.2-340s1c1
Sequence:CCGGCAGGCCGTGCTGACGGTGGATCTCGAGATCCACCGTCAGCACGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031295
ABHD11 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 11
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000050728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031295.2-305s1c1
Sequence:CCGGCTTCAACTCCATCGCCAAGATCTCGAGATCTTGGCGATGGAGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031295.2-279s1c1
Sequence:CCGGCACGGGCTCTTCGGCAGCAAACTCGAGTTTGCTGCCGAAGAGCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031295.2-211s1c1
Sequence:CCGGCGAGGCCGCTTCCGCTTTCCTCTCGAGAGGAAAGCGGAAGCGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031295.2-340s1c1
Sequence:CCGGCAGGCCGTGCTGACGGTGGATCTCGAGATCCACCGTCAGCACGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks