EMAIL THIS PAGE TO A FRIEND

ABHD12

abhydrolase domain containing 12

71 Gene Product Result for
Synonyms: ABHD12A BEM46L2 C20orf22 PHARC dJ965G21.2
Gene ID:
Human(26090) Summary: This gene encodes an enzyme that catalyzes the hydrolysis of 2-arachidonoyl glycerol (2-AG), the main endocannabinoid lipid transmitter that acts on cannabinoid receptors, CB1 and CB2. The endocannabinoid system is involved in a wide range of physiological processes, including neurotransmission, mood, appetite, pain appreciation, addiction behavior, and inflammation. Mutations in this gene are associated with the neurodegenerative disease, PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract), resulting from an inborn error of endocannabinoid metabolism. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jan 2011]
Mouse(76192) abhydrolase domain containing 12
Rat(499913) abhydrolase domain containing 12
sheep(101106539) abhydrolase domain containing 12
domestic guinea pig(100729841) abhydrolase domain containing 12
naked mole-rat(101716415) abhydrolase domain containing 12
Zebrafish(767657) abhydrolase domain containing 12
chicken(421249) abhydrolase domain containing 12
cow(768242) abhydrolase domain containing 12
domestic cat(101091357) abhydrolase domain containing 12
dog(477004) abhydrolase domain containing 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015600 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042472 Rosetta Predictions human pricing
NM_015600 Rosetta Predictions human pricing
NM_001024314 Rosetta Predictions rat pricing
NM_024465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309998 predicted 971
2 SASI_Hs02_00309999 predicted 1044
3 SASI_Hs02_00310000 predicted 419
4 SASI_Hs02_00310001 predicted 492
5 SASI_Hs02_00310002 predicted 941
6 SASI_Hs02_00310003 predicted 419
7 SASI_Hs02_00310004 predicted 393
8 SASI_Hs02_00310005 predicted 726
9 SASI_Hs02_00310006 predicted 934
10 SASI_Hs02_00310007 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348180 predicted 974
2 SASI_Hs01_00233371 predicted 1047
3 SASI_Hs01_00233372 predicted 419
4 SASI_Hs01_00233373 predicted 491
5 SASI_Hs01_00233374 predicted 938
6 SASI_Hs02_00348181 predicted 414
7 SASI_Hs01_00233375 predicted 390
8 SASI_Hs01_00233376 predicted 726
9 SASI_Hs02_00348182 predicted 932
10 SASI_Hs01_00233379 predicted 800
11 SASI_Hs01_00233377 predicted 968
12 SASI_Hs01_00233378 predicted 393
13 SASI_Hs01_00233380 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024314 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053317 predicted 432
2 SASI_Rn01_00053318 predicted 817
3 SASI_Rn02_00202523 predicted 421
4 SASI_Rn02_00202524 predicted 603
5 SASI_Rn01_00053320 predicted 398
6 SASI_Rn01_00053321 predicted 478
7 SASI_Rn01_00053323 predicted 1298
8 SASI_Rn02_00202525 predicted 989
9 SASI_Rn01_00053324 predicted 856
10 SASI_Rn01_00053326 predicted 979
11 SASI_Rn01_00053319 predicted 374
12 SASI_Rn01_00053322 predicted 411
13 SASI_Rn01_00053325 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327831 predicted 465
2 SASI_Mm02_00327832 predicted 459
3 SASI_Mm02_00327833 predicted 673
4 SASI_Mm02_00327834 predicted 839
5 SASI_Mm02_00327835 predicted 840
6 SASI_Mm02_00327836 predicted 500
7 SASI_Mm01_00021838 predicted 983
8 SASI_Mm02_00327837 predicted 419
9 SASI_Mm02_00327838 predicted 882
10 SASI_Mm02_00327839 predicted 839
11 SASI_Mm01_00021834 predicted 591
12 SASI_Mm01_00021835 predicted 798
13 SASI_Mm01_00021836 predicted 412
14 SASI_Mm01_00021837 predicted 626
15 SASI_Mm01_00021839 predicted 689
16 SASI_Mm01_00021840 predicted 418
17 SASI_Mm01_00021841 predicted 1011
18 SASI_Mm01_00021842 predicted 632
19 SASI_Mm01_00021843 predicted 630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024465
VALIDATED
ABHD12 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024465.1-290s1c1
Sequence:CCGGCCCTTATATTGGAGTCTCCATCTCGAGATGGAGACTCCAATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024465.1-495s1c1
Sequence:CCGGGCCCTTTCATCTCGGTAGAAACTCGAGTTTCTACCGAGATGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024465.1-191s1c1
Sequence:CCGGGTGGTGATAATCCTGTGTATACTCGAGTATACACAGGATTATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024465.1-407s1c1
Sequence:CCGGGCAGTGGAATTAAATTTGCAACTCGAGTTGCAAATTTAATTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024465.1-549s1c1
Sequence:CCGGCCGAGACTTCAAAGTCCAGTTCTCGAGAACTGGACTTTGAAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024465
VALIDATED
ABHD12 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024465.1-290s1c1
Sequence:CCGGCCCTTATATTGGAGTCTCCATCTCGAGATGGAGACTCCAATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024465.1-495s1c1
Sequence:CCGGGCCCTTTCATCTCGGTAGAAACTCGAGTTTCTACCGAGATGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024465.1-191s1c1
Sequence:CCGGGTGGTGATAATCCTGTGTATACTCGAGTATACACAGGATTATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024465.1-407s1c1
Sequence:CCGGGCAGTGGAATTAAATTTGCAACTCGAGTTGCAAATTTAATTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024465.1-549s1c1
Sequence:CCGGCCGAGACTTCAAAGTCCAGTTCTCGAGAACTGGACTTTGAAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024465
VALIDATED
ABHD12 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024465.1-290s1c1
Sequence:CCGGCCCTTATATTGGAGTCTCCATCTCGAGATGGAGACTCCAATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024465.1-495s1c1
Sequence:CCGGGCCCTTTCATCTCGGTAGAAACTCGAGTTTCTACCGAGATGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024465.1-191s1c1
Sequence:CCGGGTGGTGATAATCCTGTGTATACTCGAGTATACACAGGATTATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024465.1-407s1c1
Sequence:CCGGGCAGTGGAATTAAATTTGCAACTCGAGTTGCAAATTTAATTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024465.1-549s1c1
Sequence:CCGGCCGAGACTTCAAAGTCCAGTTCTCGAGAACTGGACTTTGAAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015600
ABHD12 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015600.2-1391s1c1
Sequence:CCGGCTAACCCAAAGGCAGCTGAAACTCGAGTTTCAGCTGCCTTTGGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015600.2-473s1c1
Sequence:CCGGCCACAGGATCAAGGTTTGAATCTCGAGATTCAAACCTTGATCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015600.2-1225s1c1
Sequence:CCGGCCTTGGCTACAGGCACAAATACTCGAGTATTTGTGCCTGTAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015600.2-927s1c1
Sequence:CCGGCCCTTATATTGGAATCTCCATCTCGAGATGGAGATTCCAATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015600.2-1234s1c1
Sequence:CCGGCAGGCACAAATACATTTACAACTCGAGTTGTAAATGTATTTGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015600.3-1365s21c1
Sequence:CCGGAGGTGACACGGTCATCGAAGACTCGAGTCTTCGATGACCGTGTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015600.3-422s21c1
Sequence:CCGGGAATACAGGCCAAACTGATTTCTCGAGAAATCAGTTTGGCCTGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015600.3-1049s21c1
Sequence:CCGGCTATTACAAGTAGTGGAATTACTCGAGTAATTCCACTACTTGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015600.3-1155s21c1
Sequence:CCGGGCTTGGCAGAAAGCTCTATAGCTCGAGCTATAGAGCTTTCTGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015600.3-979s21c1
Sequence:CCGGGAAGCTAAGAGCCATCCATTTCTCGAGAAATGGATGGCTCTTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015600
ABHD12 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015600.2-1391s1c1
Sequence:CCGGCTAACCCAAAGGCAGCTGAAACTCGAGTTTCAGCTGCCTTTGGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015600.2-473s1c1
Sequence:CCGGCCACAGGATCAAGGTTTGAATCTCGAGATTCAAACCTTGATCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015600.2-1225s1c1
Sequence:CCGGCCTTGGCTACAGGCACAAATACTCGAGTATTTGTGCCTGTAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015600.2-927s1c1
Sequence:CCGGCCCTTATATTGGAATCTCCATCTCGAGATGGAGATTCCAATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015600.2-1234s1c1
Sequence:CCGGCAGGCACAAATACATTTACAACTCGAGTTGTAAATGTATTTGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015600.3-1365s21c1
Sequence:CCGGAGGTGACACGGTCATCGAAGACTCGAGTCTTCGATGACCGTGTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015600.3-422s21c1
Sequence:CCGGGAATACAGGCCAAACTGATTTCTCGAGAAATCAGTTTGGCCTGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015600.3-1049s21c1
Sequence:CCGGCTATTACAAGTAGTGGAATTACTCGAGTAATTCCACTACTTGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015600.3-1155s21c1
Sequence:CCGGGCTTGGCAGAAAGCTCTATAGCTCGAGCTATAGAGCTTTCTGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015600.3-979s21c1
Sequence:CCGGGAAGCTAAGAGCCATCCATTTCTCGAGAAATGGATGGCTCTTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015600
ABHD12 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015600.2-1391s1c1
Sequence:CCGGCTAACCCAAAGGCAGCTGAAACTCGAGTTTCAGCTGCCTTTGGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015600.2-473s1c1
Sequence:CCGGCCACAGGATCAAGGTTTGAATCTCGAGATTCAAACCTTGATCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015600.2-1225s1c1
Sequence:CCGGCCTTGGCTACAGGCACAAATACTCGAGTATTTGTGCCTGTAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015600.2-927s1c1
Sequence:CCGGCCCTTATATTGGAATCTCCATCTCGAGATGGAGATTCCAATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015600.2-1234s1c1
Sequence:CCGGCAGGCACAAATACATTTACAACTCGAGTTGTAAATGTATTTGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015600.3-1365s21c1
Sequence:CCGGAGGTGACACGGTCATCGAAGACTCGAGTCTTCGATGACCGTGTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015600.3-422s21c1
Sequence:CCGGGAATACAGGCCAAACTGATTTCTCGAGAAATCAGTTTGGCCTGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015600.3-1049s21c1
Sequence:CCGGCTATTACAAGTAGTGGAATTACTCGAGTAATTCCACTACTTGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015600.3-1155s21c1
Sequence:CCGGGCTTGGCAGAAAGCTCTATAGCTCGAGCTATAGAGCTTTCTGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015600.3-979s21c1
Sequence:CCGGGAAGCTAAGAGCCATCCATTTCTCGAGAAATGGATGGCTCTTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks