EMAIL THIS PAGE TO A FRIEND

ABHD12B

abhydrolase domain containing 12B

45 Gene Product Result for
Synonyms: BEM46L3 C14orf29 c14_5314
UniProtKB ID: Q7Z5M8, Q3KNR9, Q3KNS0, Q7Z5M6, Q7Z5M7, Q8N4D2
Gene ID:
Mouse(100504285) abhydrolase domain containing 12B
Rat(408202) abhydrolase domain containing 12B
chicken(100857753) abhydrolase domain containing 12B
cow(100138482) abhydrolase domain containing 12B
domestic cat(101089111) abhydrolase domain containing 12B
dog(610765) abhydrolase domain containing 12B
naked mole-rat(101724819) abhydrolase domain containing 12B
domestic guinea pig(100721160) abhydrolase domain containing 12B
sheep(101105505) abhydrolase domain containing 12B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181533 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068991 MISSION® esiRNA esiRNA human C14orf29 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181533 Rosetta Predictions human pricing
NM_181814 Rosetta Predictions human pricing
NM_001003928 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152714 predicted 630
2 SASI_Hs01_00152715 predicted 1005
3 SASI_Hs01_00152716 predicted 457
4 SASI_Hs01_00152718 predicted 418
5 SASI_Hs01_00152719 predicted 822
6 SASI_Hs01_00152720 predicted 504
7 SASI_Hs01_00152721 predicted 855
8 SASI_Hs01_00152722 predicted 453
9 SASI_Hs02_00370150 predicted 842
10 SASI_Hs02_00370151 predicted 775
11 SASI_Hs01_00152713 predicted 1063
12 SASI_Hs01_00152717 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112384 predicted 522
2 SASI_Hs01_00112385 predicted 902
3 SASI_Hs01_00112386 predicted 352
4 SASI_Hs01_00112388 predicted 319
5 SASI_Hs01_00112389 predicted 727
6 SASI_Hs01_00112390 predicted 400
7 SASI_Hs01_00112391 predicted 745
8 SASI_Hs01_00112392 predicted 353
9 SASI_Hs02_00370418 predicted 732
10 SASI_Hs02_00370419 predicted 672
11 SASI_Hs01_00112383 predicted 969
12 SASI_Hs01_00112387 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198068 predicted 409
2 SASI_Rn01_00108065 predicted 299
3 SASI_Rn01_00108066 predicted 198
4 SASI_Rn01_00108068 predicted 389
5 SASI_Rn01_00108069 predicted 320
6 SASI_Rn01_00108070 predicted 322
7 SASI_Rn01_00108071 predicted 330
8 SASI_Rn01_00108072 predicted 333
9 SASI_Rn01_00108073 predicted 335
10 SASI_Rn01_00108074 predicted 313
11 SASI_Rn01_00108067 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181533
ABHD12B MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 12B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181533.3-1289s21c1
Sequence:CCGGAGTTGCTATGGTCCGAATATCCTCGAGGATATTCGGACCATAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181533.3-634s21c1
Sequence:CCGGGTGGGTTGCAAGTATCAATTACTCGAGTAATTGATACTTGCAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181533.3-542s21c1
Sequence:CCGGGGTACAGGAGTTGCAACAAATCTCGAGATTTGTTGCAACTCCTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181533.3-1081s1c1
Sequence:CCGGGCCATTGACTTCTCTACAAATCTCGAGATTTGTAGAGAAGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181533.3-829s1c1
Sequence:CCGGGCTCTATGAAATTGCACGCAACTCGAGTTGCGTGCAATTTCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181533.3-591s1c1
Sequence:CCGGGCCCAGTTGATGCTATTGTCTCTCGAGAGACAATAGCATCAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181533.3-293s1c1
Sequence:CCGGCGTGATGGGAACCCAATTATTCTCGAGAATAATTGGGTTCCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181533.3-592s1c1
Sequence:CCGGCCCAGTTGATGCTATTGTCTTCTCGAGAAGACAATAGCATCAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181533
ABHD12B MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 12B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181533.3-1289s21c1
Sequence:CCGGAGTTGCTATGGTCCGAATATCCTCGAGGATATTCGGACCATAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181533.3-634s21c1
Sequence:CCGGGTGGGTTGCAAGTATCAATTACTCGAGTAATTGATACTTGCAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181533.3-542s21c1
Sequence:CCGGGGTACAGGAGTTGCAACAAATCTCGAGATTTGTTGCAACTCCTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181533.3-1081s1c1
Sequence:CCGGGCCATTGACTTCTCTACAAATCTCGAGATTTGTAGAGAAGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181533.3-829s1c1
Sequence:CCGGGCTCTATGAAATTGCACGCAACTCGAGTTGCGTGCAATTTCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181533.3-591s1c1
Sequence:CCGGGCCCAGTTGATGCTATTGTCTCTCGAGAGACAATAGCATCAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181533.3-293s1c1
Sequence:CCGGCGTGATGGGAACCCAATTATTCTCGAGAATAATTGGGTTCCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181533.3-592s1c1
Sequence:CCGGCCCAGTTGATGCTATTGTCTTCTCGAGAAGACAATAGCATCAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181533
ABHD12B MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 12B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181533.3-1289s21c1
Sequence:CCGGAGTTGCTATGGTCCGAATATCCTCGAGGATATTCGGACCATAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181533.3-634s21c1
Sequence:CCGGGTGGGTTGCAAGTATCAATTACTCGAGTAATTGATACTTGCAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181533.3-542s21c1
Sequence:CCGGGGTACAGGAGTTGCAACAAATCTCGAGATTTGTTGCAACTCCTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181533.3-1081s1c1
Sequence:CCGGGCCATTGACTTCTCTACAAATCTCGAGATTTGTAGAGAAGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181533.3-829s1c1
Sequence:CCGGGCTCTATGAAATTGCACGCAACTCGAGTTGCGTGCAATTTCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181533.3-591s1c1
Sequence:CCGGGCCCAGTTGATGCTATTGTCTCTCGAGAGACAATAGCATCAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181533.3-293s1c1
Sequence:CCGGCGTGATGGGAACCCAATTATTCTCGAGAATAATTGGGTTCCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181533.3-592s1c1
Sequence:CCGGCCCAGTTGATGCTATTGTCTTCTCGAGAAGACAATAGCATCAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks