EMAIL THIS PAGE TO A FRIEND

ABHD13

abhydrolase domain containing 13

136 Gene Product Result for
Synonyms: BEM46L1 C13orf6 RP11-153I24.2 bA153I24.2
UniProtKB ID: Q7L211, B3KWE7, Q8NBW1, Q96JX9
Gene ID:
Mouse(68904) abhydrolase domain containing 13
Rat(306630) abhydrolase domain containing 13
sheep(101116488) abhydrolase domain containing 13
domestic guinea pig(100718895) abhydrolase domain containing 13
naked mole-rat(101721182) abhydrolase domain containing 13
Zebrafish(561333) abhydrolase domain containing 13
domestic cat(101088208) abhydrolase domain containing 13
cow(513848) abhydrolase domain containing 13
Horse(100065368) abhydrolase domain containing 13
dog(100686696) abhydrolase domain containing 13
chicken(418763) abhydrolase domain containing 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_133990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032859 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032859 Rosetta Predictions human pricing
NM_001107327 Rosetta Predictions rat pricing
NM_001081119 Rosetta Predictions mouse pricing
XM_133990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145733 predicted 1115
2 SASI_Hs01_00145734 predicted 706
3 SASI_Hs01_00145736 predicted 898
4 SASI_Hs02_00360457 predicted 1363
5 SASI_Hs01_00145737 predicted 659
6 SASI_Hs01_00145739 predicted 768
7 SASI_Hs01_00145740 predicted 303
8 SASI_Hs01_00145741 predicted 1066
9 SASI_Hs01_00145742 predicted 932
10 SASI_Hs02_00360458 predicted 697
11 SASI_Hs01_00145735 predicted 1178
12 SASI_Hs01_00145738 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227745 predicted 911
2 SASI_Rn02_00227746 predicted 756
3 SASI_Rn02_00227747 predicted 544
4 SASI_Rn02_00227748 predicted 1333
5 SASI_Rn02_00227749 predicted 794
6 SASI_Rn02_00227750 predicted 902
7 SASI_Rn02_00227751 predicted 1423
8 SASI_Rn02_00227752 predicted 1222
9 SASI_Rn02_00227753 predicted 791
10 SASI_Rn02_00227754 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295371 predicted 471
2 SASI_Mm02_00295372 predicted 961
3 SASI_Mm02_00295373 predicted 728
4 SASI_Mm02_00295374 predicted 972
5 SASI_Mm02_00295375 predicted 691
6 SASI_Mm02_00295376 predicted 795
7 SASI_Mm02_00295377 predicted 1119
8 SASI_Mm02_00295378 predicted 696
9 SASI_Mm02_00295379 predicted 667
10 SASI_Mm02_00295380 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245282 predicted 479
2 SASI_Mm01_00245283 predicted 728
3 SASI_Mm01_00245284 predicted 981
4 SASI_Mm01_00245285 predicted 703
5 SASI_Mm01_00245286 predicted 800
6 SASI_Mm01_00245287 predicted 1126
7 SASI_Mm01_00245288 predicted 694
8 SASI_Mm01_00245289 predicted 665
9 SASI_Mm01_00245290 predicted 614
10 SASI_Mm01_00245291 predicted 806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133990
ABHD13 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-887s1c1
Sequence:CCGGCCTTCCTTTATGGTGCTATAACTCGAGTTATAGCACCATAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-266s1c1
Sequence:CCGGGTTACCTTTGATAGTGACTTTCTCGAGAAAGTCACTATCAAAGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-387s1c1
Sequence:CCGGCCATCTTCTTCCCGCCTTTATCTCGAGATAAAGGCGGGAAGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-1031s1c1
Sequence:CCGGCCGGACTAAGAGATTAGCCATCTCGAGATGGCTAATCTCTTAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-519s1c1
Sequence:CCGGCCGACCATAATTTATTTCCATCTCGAGATGGAAATAAATTATGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133990
ABHD13 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-887s1c1
Sequence:CCGGCCTTCCTTTATGGTGCTATAACTCGAGTTATAGCACCATAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-266s1c1
Sequence:CCGGGTTACCTTTGATAGTGACTTTCTCGAGAAAGTCACTATCAAAGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-387s1c1
Sequence:CCGGCCATCTTCTTCCCGCCTTTATCTCGAGATAAAGGCGGGAAGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-1031s1c1
Sequence:CCGGCCGGACTAAGAGATTAGCCATCTCGAGATGGCTAATCTCTTAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-519s1c1
Sequence:CCGGCCGACCATAATTTATTTCCATCTCGAGATGGAAATAAATTATGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133990
ABHD13 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-887s1c1
Sequence:CCGGCCTTCCTTTATGGTGCTATAACTCGAGTTATAGCACCATAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-266s1c1
Sequence:CCGGGTTACCTTTGATAGTGACTTTCTCGAGAAAGTCACTATCAAAGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-387s1c1
Sequence:CCGGCCATCTTCTTCCCGCCTTTATCTCGAGATAAAGGCGGGAAGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-1031s1c1
Sequence:CCGGCCGGACTAAGAGATTAGCCATCTCGAGATGGCTAATCTCTTAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133990.3-519s1c1
Sequence:CCGGCCGACCATAATTTATTTCCATCTCGAGATGGAAATAAATTATGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032859
ABHD13 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-422s1c1
Sequence:CCGGCCGATGCGTTACCTTCCTTTACTCGAGTAAAGGAAGGTAACGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-539s1c1
Sequence:CCGGCCAGTAATGATGAAACAACTTCTCGAGAAGTTGTTTCATCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-433s1c1
Sequence:CCGGCCTTCCTTTATGGTGCTACAACTCGAGTTGTAGCACCATAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-160s1c1
Sequence:CCGGGCTGGTTGATTATCGAGGATACTCGAGTATCCTCGATAATCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-317s1c1
Sequence:CCGGGCTATTCATTTGGCTTCTGAACTCGAGTTCAGAAGCCAAATGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032859.2-1401s21c1
Sequence:CCGGTCACTGCTCCTTTACGATATTCTCGAGAATATCGTAAAGGAGCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032859.2-475s21c1
Sequence:CCGGGCCATCCTCTTCACGTCTTTACTCGAGTAAAGACGTGAAGAGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032859.2-552s21c1
Sequence:CCGGGAATACGTCTGAATCTTATTTCTCGAGAAATAAGATTCAGACGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032859
ABHD13 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-422s1c1
Sequence:CCGGCCGATGCGTTACCTTCCTTTACTCGAGTAAAGGAAGGTAACGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-539s1c1
Sequence:CCGGCCAGTAATGATGAAACAACTTCTCGAGAAGTTGTTTCATCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-433s1c1
Sequence:CCGGCCTTCCTTTATGGTGCTACAACTCGAGTTGTAGCACCATAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-160s1c1
Sequence:CCGGGCTGGTTGATTATCGAGGATACTCGAGTATCCTCGATAATCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-317s1c1
Sequence:CCGGGCTATTCATTTGGCTTCTGAACTCGAGTTCAGAAGCCAAATGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032859.2-1401s21c1
Sequence:CCGGTCACTGCTCCTTTACGATATTCTCGAGAATATCGTAAAGGAGCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032859.2-475s21c1
Sequence:CCGGGCCATCCTCTTCACGTCTTTACTCGAGTAAAGACGTGAAGAGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032859.2-552s21c1
Sequence:CCGGGAATACGTCTGAATCTTATTTCTCGAGAAATAAGATTCAGACGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032859
ABHD13 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-422s1c1
Sequence:CCGGCCGATGCGTTACCTTCCTTTACTCGAGTAAAGGAAGGTAACGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-539s1c1
Sequence:CCGGCCAGTAATGATGAAACAACTTCTCGAGAAGTTGTTTCATCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-433s1c1
Sequence:CCGGCCTTCCTTTATGGTGCTACAACTCGAGTTGTAGCACCATAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-160s1c1
Sequence:CCGGGCTGGTTGATTATCGAGGATACTCGAGTATCCTCGATAATCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032859.1-317s1c1
Sequence:CCGGGCTATTCATTTGGCTTCTGAACTCGAGTTCAGAAGCCAAATGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032859.2-1401s21c1
Sequence:CCGGTCACTGCTCCTTTACGATATTCTCGAGAATATCGTAAAGGAGCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032859.2-475s21c1
Sequence:CCGGGCCATCCTCTTCACGTCTTTACTCGAGTAAAGACGTGAAGAGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032859.2-552s21c1
Sequence:CCGGGAATACGTCTGAATCTTATTTCTCGAGAAATAAGATTCAGACGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks