EMAIL THIS PAGE TO A FRIEND

ABHD14A

abhydrolase domain containing 14A

90 Gene Product Result for
Synonyms: DORZ1
UniProtKB ID: Q9BUJ0, Q6UXU8, Q9Y3T7
Gene ID:
Mouse(68644) abhydrolase domain containing 14A
Rat(300982) abhydrolase domain containing 14A
Zebrafish(404598) abhydrolase domain containing 14A
chicken(100858554) abhydrolase domain containing 14A
cow(515122) abhydrolase domain containing 14A
domestic cat(101100703) abhydrolase domain containing 14A
dog(484743) abhydrolase domain containing 14A
naked mole-rat(101697510) abhydrolase domain containing 14A
domestic guinea pig(100722756) abhydrolase domain containing 14A
sheep(101114562) abhydrolase domain containing 14A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015407 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015407 Rosetta Predictions human pricing
NM_001009670 Rosetta Predictions rat pricing
NM_001110271 Rosetta Predictions mouse pricing
NM_001110272 Rosetta Predictions mouse pricing
NM_145919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107893 predicted 680
2 SASI_Hs01_00107894 predicted 699
3 SASI_Hs01_00107895 predicted 371
4 SASI_Hs01_00107896 predicted 467
5 SASI_Hs01_00107897 predicted 733
6 SASI_Hs01_00107898 predicted 687
7 SASI_Hs01_00107899 predicted 730
8 SASI_Hs01_00107901 predicted 292
9 SASI_Hs01_00107902 predicted 831
10 SASI_Hs02_00347772 predicted 776
11 SASI_Hs01_00107900 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041720 predicted 955
2 SASI_Rn01_00041721 predicted 624
3 SASI_Rn01_00041722 predicted 716
4 SASI_Rn01_00041723 predicted 541
5 SASI_Rn02_00199705 predicted 1027
6 SASI_Rn01_00041724 predicted 739
7 SASI_Rn02_00199706 predicted 714
8 SASI_Rn01_00041726 predicted 906
9 SASI_Rn02_00199707 predicted 956
10 SASI_Rn01_00041728 predicted 958
11 SASI_Rn01_00041725 predicted 782
12 SASI_Rn01_00041727 predicted 1100
13 SASI_Rn01_00041729 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110271 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305236 predicted 1055
2 SASI_Mm02_00305237 predicted 1059
3 SASI_Mm02_00305238 predicted 985
4 SASI_Mm02_00305239 predicted 1050
5 SASI_Mm02_00305240 predicted 1104
6 SASI_Mm02_00305241 predicted 1098
7 SASI_Mm02_00305242 predicted 1101
8 SASI_Mm02_00305243 predicted 1079
9 SASI_Mm02_00305244 predicted 1105
10 SASI_Mm02_00305245 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305246 predicted 736
2 SASI_Mm02_00305247 predicted 805
3 SASI_Mm02_00305248 predicted 800
4 SASI_Mm02_00305249 predicted 729
5 SASI_Mm02_00305250 predicted 793
6 SASI_Mm02_00305251 predicted 851
7 SASI_Mm02_00305252 predicted 842
8 SASI_Mm02_00305253 predicted 839
9 SASI_Mm02_00305254 predicted 825
10 SASI_Mm02_00305255 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341363 predicted 934
2 SASI_Mm02_00341364 predicted 933
3 SASI_Mm02_00341365 predicted 862
4 SASI_Mm02_00341366 predicted 925
5 SASI_Mm02_00341367 predicted 981
6 SASI_Mm02_00341368 predicted 977
7 SASI_Mm02_00341369 predicted 978
8 SASI_Mm02_00341370 predicted 957
9 SASI_Mm02_00341371 predicted 979
10 SASI_Mm02_00341372 predicted 944
11 SASI_Mm01_00170864 predicted 746
12 SASI_Mm01_00170865 predicted 418
13 SASI_Mm01_00170866 predicted 822
14 SASI_Mm01_00170867 predicted 573
15 SASI_Mm01_00170868 predicted 705
16 SASI_Mm01_00170869 predicted 937
17 SASI_Mm01_00170870 predicted 817
18 SASI_Mm01_00170871 predicted 355
19 SASI_Mm01_00170872 predicted 948
20 SASI_Mm01_00170873 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015407
VALIDATED
ABHD14A MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 14A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-238s21c1
Sequence:CCGGTGCTCATGCTCCTACTGTATGCTCGAGCATACAGTAGGAGCATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-829s21c1
Sequence:CCGGCTGTGGTGAAGCTACGCAATGCTCGAGCATTGCGTAGCTTCACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-407s21c1
Sequence:CCGGGCTTCATGGAAAGGCCTTTAACTCGAGTTAAAGGCCTTTCCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-710s21c1
Sequence:CCGGGAACTACACCCAGGAGCAATTCTCGAGAATTGCTCCTGGGTGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-863s21c1
Sequence:CCGGTTACCTCCACAAGCCGCAAGACTCGAGTCTTGCGGCTTGTGGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015407.3-629s1c1
Sequence:CCGGGCTACATGGATTTGTGCCCATCTCGAGATGGGCACAAATCCATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015407.3-365s1c1
Sequence:CCGGGCTTCATGGAAAGGCCTTTAACTCGAGTTAAAGGCCTTTCCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015407.3-862s1c1
Sequence:CCGGCCTTCCTTGACCATCTACCTTCTCGAGAAGGTAGATGGTCAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015407.3-705s1c1
Sequence:CCGGCCAACCCTTATCCTGTATGGACTCGAGTCCATACAGGATAAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015407.3-294s1c1
Sequence:CCGGCCTGGCAACTCGCCCATCTTTCTCGAGAAAGATGGGCGAGTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015407
VALIDATED
ABHD14A MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 14A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-238s21c1
Sequence:CCGGTGCTCATGCTCCTACTGTATGCTCGAGCATACAGTAGGAGCATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-829s21c1
Sequence:CCGGCTGTGGTGAAGCTACGCAATGCTCGAGCATTGCGTAGCTTCACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-407s21c1
Sequence:CCGGGCTTCATGGAAAGGCCTTTAACTCGAGTTAAAGGCCTTTCCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-710s21c1
Sequence:CCGGGAACTACACCCAGGAGCAATTCTCGAGAATTGCTCCTGGGTGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-863s21c1
Sequence:CCGGTTACCTCCACAAGCCGCAAGACTCGAGTCTTGCGGCTTGTGGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015407.3-629s1c1
Sequence:CCGGGCTACATGGATTTGTGCCCATCTCGAGATGGGCACAAATCCATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015407.3-365s1c1
Sequence:CCGGGCTTCATGGAAAGGCCTTTAACTCGAGTTAAAGGCCTTTCCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015407.3-862s1c1
Sequence:CCGGCCTTCCTTGACCATCTACCTTCTCGAGAAGGTAGATGGTCAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015407.3-705s1c1
Sequence:CCGGCCAACCCTTATCCTGTATGGACTCGAGTCCATACAGGATAAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015407.3-294s1c1
Sequence:CCGGCCTGGCAACTCGCCCATCTTTCTCGAGAAAGATGGGCGAGTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015407
VALIDATED
ABHD14A MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 14A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-238s21c1
Sequence:CCGGTGCTCATGCTCCTACTGTATGCTCGAGCATACAGTAGGAGCATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-829s21c1
Sequence:CCGGCTGTGGTGAAGCTACGCAATGCTCGAGCATTGCGTAGCTTCACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-407s21c1
Sequence:CCGGGCTTCATGGAAAGGCCTTTAACTCGAGTTAAAGGCCTTTCCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-710s21c1
Sequence:CCGGGAACTACACCCAGGAGCAATTCTCGAGAATTGCTCCTGGGTGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015407.4-863s21c1
Sequence:CCGGTTACCTCCACAAGCCGCAAGACTCGAGTCTTGCGGCTTGTGGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015407.3-629s1c1
Sequence:CCGGGCTACATGGATTTGTGCCCATCTCGAGATGGGCACAAATCCATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015407.3-365s1c1
Sequence:CCGGGCTTCATGGAAAGGCCTTTAACTCGAGTTAAAGGCCTTTCCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015407.3-862s1c1
Sequence:CCGGCCTTCCTTGACCATCTACCTTCTCGAGAAGGTAGATGGTCAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015407.3-705s1c1
Sequence:CCGGCCAACCCTTATCCTGTATGGACTCGAGTCCATACAGGATAAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015407.3-294s1c1
Sequence:CCGGCCTGGCAACTCGCCCATCTTTCTCGAGAAAGATGGGCGAGTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145919
VALIDATED
ABHD14A MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 14A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145919.1-355s1c1
Sequence:CCGGGCTCGTGTTCCTCCTGTATATCTCGAGATATACAGGAGGAACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145919.1-977s1c1
Sequence:CCGGCGCTACCTCCATAAGCCAGAACTCGAGTTCTGGCTTATGGAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145919.1-509s1c1
Sequence:CCGGGCAGAAGTCGTGTTTCTCCATCTCGAGATGGAGAAACACGACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145919.1-824s1c1
Sequence:CCGGAGGAATTATGCACAGGAACAACTCGAGTTGTTCCTGTGCATAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145919.1-787s1c1
Sequence:CCGGGCTACGTGGATTCGTGCCCATCTCGAGATGGGCACGAATCCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145919
VALIDATED
ABHD14A MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 14A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145919.1-355s1c1
Sequence:CCGGGCTCGTGTTCCTCCTGTATATCTCGAGATATACAGGAGGAACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145919.1-977s1c1
Sequence:CCGGCGCTACCTCCATAAGCCAGAACTCGAGTTCTGGCTTATGGAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145919.1-509s1c1
Sequence:CCGGGCAGAAGTCGTGTTTCTCCATCTCGAGATGGAGAAACACGACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145919.1-824s1c1
Sequence:CCGGAGGAATTATGCACAGGAACAACTCGAGTTGTTCCTGTGCATAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145919.1-787s1c1
Sequence:CCGGGCTACGTGGATTCGTGCCCATCTCGAGATGGGCACGAATCCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145919
VALIDATED
ABHD14A MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 14A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145919.1-355s1c1
Sequence:CCGGGCTCGTGTTCCTCCTGTATATCTCGAGATATACAGGAGGAACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145919.1-977s1c1
Sequence:CCGGCGCTACCTCCATAAGCCAGAACTCGAGTTCTGGCTTATGGAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145919.1-509s1c1
Sequence:CCGGGCAGAAGTCGTGTTTCTCCATCTCGAGATGGAGAAACACGACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145919.1-824s1c1
Sequence:CCGGAGGAATTATGCACAGGAACAACTCGAGTTGTTCCTGTGCATAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145919.1-787s1c1
Sequence:CCGGGCTACGTGGATTCGTGCCCATCTCGAGATGGGCACGAATCCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks