EMAIL THIS PAGE TO A FRIEND

ABHD14B

abhydrolase domain containing 14B

72 Gene Product Result for
Synonyms: CIB
UniProtKB ID: Q96IU4, Q86VK8, Q8N8W5
Gene ID:
Mouse(76491) abhydrolase domain containing 14b
Rat(300983) abhydrolase domain containing 14b
Zebrafish(393338) abhydrolase domain containing 14B
dog(484744) abhydrolase domain containing 14B
domestic cat(101092170) abhydrolase domain containing 14B
cow(615289) abhydrolase domain containing 14B
sheep(101114818) abhydrolase domain containing 14B
domestic guinea pig(100714050) abhydrolase domain containing 14B
naked mole-rat(101698120) abhydrolase domain containing 14B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032750 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032750 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032750 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059271 MISSION® esiRNA esiRNA human ABHD14B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032750 Rosetta Predictions human pricing
NM_001007664 Rosetta Predictions rat pricing
NM_029631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207404 predicted 1326
2 SASI_Hs01_00207405 predicted 1345
3 SASI_Hs01_00207406 predicted 1355
4 SASI_Hs01_00207407 predicted 715
5 SASI_Hs01_00207408 predicted 1370
6 SASI_Hs01_00207409 predicted 412
7 SASI_Hs01_00207410 predicted 1325
8 SASI_Hs01_00207411 predicted 1337
9 SASI_Hs01_00207412 predicted 596
10 SASI_Hs01_00207413 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109535 predicted 508
2 SASI_Rn01_00109536 predicted 1066
3 SASI_Rn01_00109537 predicted 909
4 SASI_Rn01_00109538 predicted 1040
5 SASI_Rn01_00109540 predicted 901
6 SASI_Rn01_00109541 predicted 414
7 SASI_Rn02_00198791 predicted 521
8 SASI_Rn01_00109542 predicted 395
9 SASI_Rn01_00109543 predicted 474
10 SASI_Rn01_00109544 predicted 1077
11 SASI_Rn01_00109539 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176289 predicted 865
2 SASI_Mm01_00176290 predicted 868
3 SASI_Mm01_00176291 predicted 922
4 SASI_Mm02_00335623 predicted 918
5 SASI_Mm01_00176292 predicted 725
6 SASI_Mm01_00176293 predicted 1075
7 SASI_Mm01_00176294 predicted 278
8 SASI_Mm01_00176295 predicted 393
9 SASI_Mm01_00176296 predicted 532
10 SASI_Mm01_00176298 predicted 692
11 SASI_Mm01_00176297 predicted 913
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029631
VALIDATED
ABHD14B MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 14B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029631.2-1237s1c1
Sequence:CCGGCCGCTAGATTTCTCTTACCTACTCGAGTAGGTAAGAGAAATCTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029631.2-469s1c1
Sequence:CCGGGCTCCTATCTGCACAGACAAACTCGAGTTTGTCTGTGCAGATAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029631.2-394s1c1
Sequence:CCGGCCATCATTAAGTGGCATGTATCTCGAGATACATGCCACTTAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029631.2-627s1c1
Sequence:CCGGGCATCCCTGTTACTTGGACAACTCGAGTTGTCCAAGTAACAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029631.2-262s1c1
Sequence:CCGGGCCATTGATCTGCCAGGTCTTCTCGAGAAGACCTGGCAGATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029631.3-719s21c1
Sequence:CCGGGAGACTCAGTCCTGATGATAGCTCGAGCTATCATCAGGACTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029631.3-197s21c1
Sequence:CCGGTGCTGCATGGTATCCGCTTCTCTCGAGAGAAGCGGATACCATGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029631.3-536s21c1
Sequence:CCGGTGAAGACTCCAGCTCTCATTGCTCGAGCAATGAGAGCTGGAGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029631.3-1253s21c1
Sequence:CCGGCCGCTAGATTTCTCTTACCTACTCGAGTAGGTAAGAGAAATCTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029631.3-490s21c1
Sequence:CCGGGCTCCTATCTGCACAGACAAACTCGAGTTTGTCTGTGCAGATAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029631
VALIDATED
ABHD14B MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 14B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029631.2-1237s1c1
Sequence:CCGGCCGCTAGATTTCTCTTACCTACTCGAGTAGGTAAGAGAAATCTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029631.2-469s1c1
Sequence:CCGGGCTCCTATCTGCACAGACAAACTCGAGTTTGTCTGTGCAGATAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029631.2-394s1c1
Sequence:CCGGCCATCATTAAGTGGCATGTATCTCGAGATACATGCCACTTAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029631.2-627s1c1
Sequence:CCGGGCATCCCTGTTACTTGGACAACTCGAGTTGTCCAAGTAACAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029631.2-262s1c1
Sequence:CCGGGCCATTGATCTGCCAGGTCTTCTCGAGAAGACCTGGCAGATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029631.3-719s21c1
Sequence:CCGGGAGACTCAGTCCTGATGATAGCTCGAGCTATCATCAGGACTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029631.3-197s21c1
Sequence:CCGGTGCTGCATGGTATCCGCTTCTCTCGAGAGAAGCGGATACCATGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029631.3-536s21c1
Sequence:CCGGTGAAGACTCCAGCTCTCATTGCTCGAGCAATGAGAGCTGGAGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029631.3-1253s21c1
Sequence:CCGGCCGCTAGATTTCTCTTACCTACTCGAGTAGGTAAGAGAAATCTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029631.3-490s21c1
Sequence:CCGGGCTCCTATCTGCACAGACAAACTCGAGTTTGTCTGTGCAGATAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029631
VALIDATED
ABHD14B MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 14B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029631.2-1237s1c1
Sequence:CCGGCCGCTAGATTTCTCTTACCTACTCGAGTAGGTAAGAGAAATCTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029631.2-469s1c1
Sequence:CCGGGCTCCTATCTGCACAGACAAACTCGAGTTTGTCTGTGCAGATAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029631.2-394s1c1
Sequence:CCGGCCATCATTAAGTGGCATGTATCTCGAGATACATGCCACTTAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029631.2-627s1c1
Sequence:CCGGGCATCCCTGTTACTTGGACAACTCGAGTTGTCCAAGTAACAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029631.2-262s1c1
Sequence:CCGGGCCATTGATCTGCCAGGTCTTCTCGAGAAGACCTGGCAGATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029631.3-719s21c1
Sequence:CCGGGAGACTCAGTCCTGATGATAGCTCGAGCTATCATCAGGACTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029631.3-197s21c1
Sequence:CCGGTGCTGCATGGTATCCGCTTCTCTCGAGAGAAGCGGATACCATGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029631.3-536s21c1
Sequence:CCGGTGAAGACTCCAGCTCTCATTGCTCGAGCAATGAGAGCTGGAGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029631.3-1253s21c1
Sequence:CCGGCCGCTAGATTTCTCTTACCTACTCGAGTAGGTAAGAGAAATCTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029631.3-490s21c1
Sequence:CCGGGCTCCTATCTGCACAGACAAACTCGAGTTTGTCTGTGCAGATAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032750
ABHD14B MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 14B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032750.1-849s1c1
Sequence:CCGGGACAAACCAGAGGAGTGGCATCTCGAGATGCCACTCCTCTGGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032750.1-724s1c1
Sequence:CCGGAGACTCCAGCTCTGATTGTATCTCGAGATACAATCAGAGCTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032750.1-375s1c1
Sequence:CCGGGTACTGCTGCTGCATGGTATTCTCGAGAATACCATGCAGCAGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032750.1-704s1c1
Sequence:CCGGTGCCAACTATGCCAGTGTGAACTCGAGTTCACACTGGCATAGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032750.1-1349s1c1
Sequence:CCGGGCCATCCTTGTTTCCAAATATCTCGAGATATTTGGAAACAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032750.2-1748s21c1
Sequence:CCGGATAATCCTGTGGAGGGTAATCCTCGAGGATTACCCTCCACAGGATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032750.2-1386s21c1
Sequence:CCGGGACCAGCTTTGAGCACCTGAACTCGAGTTCAGGTGCTCAAAGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032750.2-1201s21c1
Sequence:CCGGCCGGTTGTGATCAGTCCATCACTCGAGTGATGGACTGATCACAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032750.2-1619s21c1
Sequence:CCGGACAGGTGCGTCTGTCTATATGCTCGAGCATATAGACAGACGCACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032750
ABHD14B MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 14B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032750.1-849s1c1
Sequence:CCGGGACAAACCAGAGGAGTGGCATCTCGAGATGCCACTCCTCTGGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032750.1-724s1c1
Sequence:CCGGAGACTCCAGCTCTGATTGTATCTCGAGATACAATCAGAGCTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032750.1-375s1c1
Sequence:CCGGGTACTGCTGCTGCATGGTATTCTCGAGAATACCATGCAGCAGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032750.1-704s1c1
Sequence:CCGGTGCCAACTATGCCAGTGTGAACTCGAGTTCACACTGGCATAGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032750.1-1349s1c1
Sequence:CCGGGCCATCCTTGTTTCCAAATATCTCGAGATATTTGGAAACAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032750.2-1748s21c1
Sequence:CCGGATAATCCTGTGGAGGGTAATCCTCGAGGATTACCCTCCACAGGATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032750.2-1386s21c1
Sequence:CCGGGACCAGCTTTGAGCACCTGAACTCGAGTTCAGGTGCTCAAAGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032750.2-1201s21c1
Sequence:CCGGCCGGTTGTGATCAGTCCATCACTCGAGTGATGGACTGATCACAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032750.2-1619s21c1
Sequence:CCGGACAGGTGCGTCTGTCTATATGCTCGAGCATATAGACAGACGCACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032750
ABHD14B MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 14B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032750.1-849s1c1
Sequence:CCGGGACAAACCAGAGGAGTGGCATCTCGAGATGCCACTCCTCTGGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032750.1-724s1c1
Sequence:CCGGAGACTCCAGCTCTGATTGTATCTCGAGATACAATCAGAGCTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032750.1-375s1c1
Sequence:CCGGGTACTGCTGCTGCATGGTATTCTCGAGAATACCATGCAGCAGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032750.1-704s1c1
Sequence:CCGGTGCCAACTATGCCAGTGTGAACTCGAGTTCACACTGGCATAGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032750.1-1349s1c1
Sequence:CCGGGCCATCCTTGTTTCCAAATATCTCGAGATATTTGGAAACAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032750.2-1748s21c1
Sequence:CCGGATAATCCTGTGGAGGGTAATCCTCGAGGATTACCCTCCACAGGATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032750.2-1386s21c1
Sequence:CCGGGACCAGCTTTGAGCACCTGAACTCGAGTTCAGGTGCTCAAAGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032750.2-1201s21c1
Sequence:CCGGCCGGTTGTGATCAGTCCATCACTCGAGTGATGGACTGATCACAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032750.2-1619s21c1
Sequence:CCGGACAGGTGCGTCTGTCTATATGCTCGAGCATATAGACAGACGCACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks