EMAIL THIS PAGE TO A FRIEND

ABHD15

abhydrolase domain containing 15

UniProtKB ID: Q6UXT9, Q96EC5
Gene ID:
Mouse(67477) abhydrolase domain containing 15
Rat(303343) abhydrolase domain containing 15
naked mole-rat(101698787) abhydrolase domain containing 15
domestic guinea pig(100719781) abhydrolase domain containing 15
sheep(101121787) abhydrolase domain containing 15
cow(528755) abhydrolase domain containing 15
domestic cat(101083556) abhydrolase domain containing 15
dog(491179) abhydrolase domain containing 15
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA014470 Anti-ABHD15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2104270 Anti-LOC116236 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, rabbit, rat, horse, bovine, human
western blot pricing
SAB2104097 Anti-LOC116236, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, human, rabbit, rat, horse, mouse, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198147 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198147 Rosetta Predictions human pricing
NM_001107025 Rosetta Predictions rat pricing
NM_026185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371678 predicted 1818
2 SASI_Hs01_00039292 predicted 751
3 SASI_Hs01_00039293 predicted 1161
4 SASI_Hs01_00039294 predicted 1289
5 SASI_Hs01_00039295 predicted 967
6 SASI_Hs02_00371679 predicted 753
7 SASI_Hs01_00039296 predicted 590
8 SASI_Hs01_00039298 predicted 1940
9 SASI_Hs02_00371680 predicted 383
10 SASI_Hs01_00039299 predicted 1916
11 SASI_Hs01_00039291 predicted 1734
12 SASI_Hs01_00039297 predicted 1749
13 SASI_Hs01_00039300 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224746 predicted 1029
2 SASI_Rn02_00224747 predicted 1571
3 SASI_Rn02_00224748 predicted 1267
4 SASI_Rn02_00224749 predicted 1003
5 SASI_Rn02_00224750 predicted 1699
6 SASI_Rn02_00224751 predicted 597
7 SASI_Rn02_00224752 predicted 1655
8 SASI_Rn02_00224753 predicted 1556
9 SASI_Rn02_00224754 predicted 1305
10 SASI_Rn02_00224755 predicted 1488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329827 predicted 603
2 SASI_Mm01_00145547 predicted 1626
3 SASI_Mm01_00145554 predicted 1526
4 SASI_Mm01_00145555 predicted 373
5 SASI_Mm02_00329828 predicted 1186
6 SASI_Mm02_00329829 predicted 1048
7 SASI_Mm02_00329830 predicted 704
8 SASI_Mm02_00329831 predicted 1293
9 SASI_Mm02_00329832 predicted 1728
10 SASI_Mm02_00329833 predicted 471
11 SASI_Mm01_00145546 predicted 1574
12 SASI_Mm01_00145548 predicted 1293
13 SASI_Mm01_00145549 predicted 900
14 SASI_Mm01_00145550 predicted 1012
15 SASI_Mm01_00145551 predicted 1173
16 SASI_Mm01_00145552 predicted 1269
17 SASI_Mm01_00145553 predicted 375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198147
VALIDATED
ABHD15 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 15
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198147.1-1165s21c1
Sequence:CCGGCCACACTCTGACAACTGAACTCTCGAGAGTTCAGTTGTCAGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198147.1-2490s21c1
Sequence:CCGGGCTGACCAGTGATTTACAAATCTCGAGATTTGTAAATCACTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198147.1-1872s21c1
Sequence:CCGGGCTGGAGCCATTTGATGTCATCTCGAGATGACATCAAATGGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198147.1-1683s21c1
Sequence:CCGGGCTCAACATATCCCTACTCATCTCGAGATGAGTAGGGATATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198147.1-1322s21c1
Sequence:CCGGCGAACGGAGGAGAGGATTAAACTCGAGTTTAATCCTCTCCTCCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198147.1-1305s1c1
Sequence:CCGGCCTTGACTGAGTTCTTCCGAACTCGAGTTCGGAAGAACTCAGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-1872s1c1
Sequence:CCGGGCTGGAGCCATTTGATGTCATCTCGAGATGACATCAAATGGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-1165s1c1
Sequence:CCGGCCACACTCTGACAACTGAACTCTCGAGAGTTCAGTTGTCAGAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-1322s1c1
Sequence:CCGGCGAACGGAGGAGAGGATTAAACTCGAGTTTAATCCTCTCCTCCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-2224s1c1
Sequence:CCGGCCATGGTTCAAGGAGTCAGAACTCGAGTTCTGACTCCTTGAACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-2310s1c1
Sequence:CCGGGAACTGTTTATCTCCTGAGATCTCGAGATCTCAGGAGATAAACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-2490s1c1
Sequence:CCGGGCTGACCAGTGATTTACAAATCTCGAGATTTGTAAATCACTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-2596s1c1
Sequence:CCGGCTCAGCAAATAAGTGGGTATTCTCGAGAATACCCACTTATTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-1433s1c1
Sequence:CCGGGAGGAGATCTTTAACTGGAAGCTCGAGCTTCCAGTTAAAGATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198147.1-1683s1c1
Sequence:CCGGGCTCAACATATCCCTACTCATCTCGAGATGAGTAGGGATATGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198147
VALIDATED
ABHD15 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 15
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198147.1-1165s21c1
Sequence:CCGGCCACACTCTGACAACTGAACTCTCGAGAGTTCAGTTGTCAGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198147.1-2490s21c1
Sequence:CCGGGCTGACCAGTGATTTACAAATCTCGAGATTTGTAAATCACTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198147.1-1872s21c1
Sequence:CCGGGCTGGAGCCATTTGATGTCATCTCGAGATGACATCAAATGGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198147.1-1683s21c1
Sequence:CCGGGCTCAACATATCCCTACTCATCTCGAGATGAGTAGGGATATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198147.1-1322s21c1
Sequence:CCGGCGAACGGAGGAGAGGATTAAACTCGAGTTTAATCCTCTCCTCCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198147.1-1305s1c1
Sequence:CCGGCCTTGACTGAGTTCTTCCGAACTCGAGTTCGGAAGAACTCAGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-1872s1c1
Sequence:CCGGGCTGGAGCCATTTGATGTCATCTCGAGATGACATCAAATGGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-1165s1c1
Sequence:CCGGCCACACTCTGACAACTGAACTCTCGAGAGTTCAGTTGTCAGAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-1322s1c1
Sequence:CCGGCGAACGGAGGAGAGGATTAAACTCGAGTTTAATCCTCTCCTCCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-2224s1c1
Sequence:CCGGCCATGGTTCAAGGAGTCAGAACTCGAGTTCTGACTCCTTGAACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-2310s1c1
Sequence:CCGGGAACTGTTTATCTCCTGAGATCTCGAGATCTCAGGAGATAAACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-2490s1c1
Sequence:CCGGGCTGACCAGTGATTTACAAATCTCGAGATTTGTAAATCACTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-2596s1c1
Sequence:CCGGCTCAGCAAATAAGTGGGTATTCTCGAGAATACCCACTTATTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-1433s1c1
Sequence:CCGGGAGGAGATCTTTAACTGGAAGCTCGAGCTTCCAGTTAAAGATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198147.1-1683s1c1
Sequence:CCGGGCTCAACATATCCCTACTCATCTCGAGATGAGTAGGGATATGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198147
VALIDATED
ABHD15 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 15
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198147.1-1165s21c1
Sequence:CCGGCCACACTCTGACAACTGAACTCTCGAGAGTTCAGTTGTCAGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198147.1-2490s21c1
Sequence:CCGGGCTGACCAGTGATTTACAAATCTCGAGATTTGTAAATCACTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198147.1-1872s21c1
Sequence:CCGGGCTGGAGCCATTTGATGTCATCTCGAGATGACATCAAATGGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198147.1-1683s21c1
Sequence:CCGGGCTCAACATATCCCTACTCATCTCGAGATGAGTAGGGATATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198147.1-1322s21c1
Sequence:CCGGCGAACGGAGGAGAGGATTAAACTCGAGTTTAATCCTCTCCTCCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198147.1-1305s1c1
Sequence:CCGGCCTTGACTGAGTTCTTCCGAACTCGAGTTCGGAAGAACTCAGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-1872s1c1
Sequence:CCGGGCTGGAGCCATTTGATGTCATCTCGAGATGACATCAAATGGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-1165s1c1
Sequence:CCGGCCACACTCTGACAACTGAACTCTCGAGAGTTCAGTTGTCAGAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-1322s1c1
Sequence:CCGGCGAACGGAGGAGAGGATTAAACTCGAGTTTAATCCTCTCCTCCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-2224s1c1
Sequence:CCGGCCATGGTTCAAGGAGTCAGAACTCGAGTTCTGACTCCTTGAACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-2310s1c1
Sequence:CCGGGAACTGTTTATCTCCTGAGATCTCGAGATCTCAGGAGATAAACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-2490s1c1
Sequence:CCGGGCTGACCAGTGATTTACAAATCTCGAGATTTGTAAATCACTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-2596s1c1
Sequence:CCGGCTCAGCAAATAAGTGGGTATTCTCGAGAATACCCACTTATTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198147.1-1433s1c1
Sequence:CCGGGAGGAGATCTTTAACTGGAAGCTCGAGCTTCCAGTTAAAGATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163540    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198147.1-1683s1c1
Sequence:CCGGGCTCAACATATCCCTACTCATCTCGAGATGAGTAGGGATATGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026185
ABHD15 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 15
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026185.1-370s1c1
Sequence:CCGGCAAACCTTCTGCCACTTCATCCTCGAGGATGAAGTGGCAGAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026185.1-706s1c1
Sequence:CCGGGTGACTTACATTCGCTTCCGACTCGAGTCGGAAGCGAATGTAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026185.1-708s1c1
Sequence:CCGGGACTTACATTCGCTTCCGACACTCGAGTGTCGGAAGCGAATGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026185.1-369s1c1
Sequence:CCGGGCAAACCTTCTGCCACTTCATCTCGAGATGAAGTGGCAGAAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026185.1-1731s1c1
Sequence:CCGGGATGAACTTGTGAGAGTCAATCTCGAGATTGACTCTCACAAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026185.1-1310s1c1
Sequence:CCGGCGAATGGAAGAGAGAATGAAACTCGAGTTTCATTCTCTCTTCCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026185.1-1309s1c1
Sequence:CCGGCCGAATGGAAGAGAGAATGAACTCGAGTTCATTCTCTCTTCCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026185.1-1629s1c1
Sequence:CCGGGCCACTATTTCCTGTCATCAACTCGAGTTGATGACAGGAAATAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026185.1-2143s1c1
Sequence:CCGGCGTTAGGTCATGGTTGTGGTACTCGAGTACCACAACCATGACCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026185
ABHD15 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 15
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026185.1-370s1c1
Sequence:CCGGCAAACCTTCTGCCACTTCATCCTCGAGGATGAAGTGGCAGAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026185.1-706s1c1
Sequence:CCGGGTGACTTACATTCGCTTCCGACTCGAGTCGGAAGCGAATGTAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026185.1-708s1c1
Sequence:CCGGGACTTACATTCGCTTCCGACACTCGAGTGTCGGAAGCGAATGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026185.1-369s1c1
Sequence:CCGGGCAAACCTTCTGCCACTTCATCTCGAGATGAAGTGGCAGAAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026185.1-1731s1c1
Sequence:CCGGGATGAACTTGTGAGAGTCAATCTCGAGATTGACTCTCACAAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026185.1-1310s1c1
Sequence:CCGGCGAATGGAAGAGAGAATGAAACTCGAGTTTCATTCTCTCTTCCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026185.1-1309s1c1
Sequence:CCGGCCGAATGGAAGAGAGAATGAACTCGAGTTCATTCTCTCTTCCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026185.1-1629s1c1
Sequence:CCGGGCCACTATTTCCTGTCATCAACTCGAGTTGATGACAGGAAATAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026185.1-2143s1c1
Sequence:CCGGCGTTAGGTCATGGTTGTGGTACTCGAGTACCACAACCATGACCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026185
ABHD15 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 15
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026185.1-370s1c1
Sequence:CCGGCAAACCTTCTGCCACTTCATCCTCGAGGATGAAGTGGCAGAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026185.1-706s1c1
Sequence:CCGGGTGACTTACATTCGCTTCCGACTCGAGTCGGAAGCGAATGTAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026185.1-708s1c1
Sequence:CCGGGACTTACATTCGCTTCCGACACTCGAGTGTCGGAAGCGAATGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026185.1-369s1c1
Sequence:CCGGGCAAACCTTCTGCCACTTCATCTCGAGATGAAGTGGCAGAAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026185.1-1731s1c1
Sequence:CCGGGATGAACTTGTGAGAGTCAATCTCGAGATTGACTCTCACAAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026185.1-1310s1c1
Sequence:CCGGCGAATGGAAGAGAGAATGAAACTCGAGTTTCATTCTCTCTTCCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026185.1-1309s1c1
Sequence:CCGGCCGAATGGAAGAGAGAATGAACTCGAGTTCATTCTCTCTTCCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026185.1-1629s1c1
Sequence:CCGGGCCACTATTTCCTGTCATCAACTCGAGTTGATGACAGGAAATAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026185.1-2143s1c1
Sequence:CCGGCGTTAGGTCATGGTTGTGGTACTCGAGTACCACAACCATGACCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks