EMAIL THIS PAGE TO A FRIEND

ABHD16A

abhydrolase domain containing 16A

73 Gene Product Result for
Synonyms: BAT5 D6S82E NG26 PP199
Gene ID:
Human(7920) Summary: A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for tumor necrosis factor alpha and tumor necrosis factor beta. These genes are all within the human major histocompatibility complex class III region. The protein encoded by this gene is thought to be involved in some aspects of immunity. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Mouse(193742) abhydrolase domain containing 16A
Rat(361796) abhydrolase domain containing 16A
Zebrafish(564613) abhydrolase domain containing 16A
Horse(100058736) abhydrolase domain containing 16A
cow(513252) abhydrolase domain containing 16A
domestic cat(101088082) abhydrolase domain containing 16A
dog(474845) abhydrolase domain containing 16A
sheep(101118906) abhydrolase domain containing 16A
domestic guinea pig(100731667) abhydrolase domain containing 16A
naked mole-rat(101706729) abhydrolase domain containing 16A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021160 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021160 Rosetta Predictions human pricing
NM_212531 Rosetta Predictions rat pricing
NM_178592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121647 predicted 225
2 SASI_Hs01_00121648 predicted 278
3 SASI_Hs01_00121649 predicted 1276
4 SASI_Hs02_00354709 predicted 703
5 SASI_Hs02_00354710 predicted 1607
6 SASI_Hs01_00121650 predicted 1064
7 SASI_Hs01_00121651 predicted 639
8 SASI_Hs01_00121652 predicted 279
9 SASI_Hs01_00121653 predicted 808
10 SASI_Hs01_00121655 predicted 273
11 SASI_Hs01_00121654 predicted 1632
12 SASI_Hs01_00121656 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270552 predicted 1404
2 SASI_Rn01_00072477 predicted 662
3 SASI_Rn01_00072478 predicted 1656
4 SASI_Rn01_00072479 predicted 675
5 SASI_Rn02_00270553 predicted 761
6 SASI_Rn01_00072480 predicted 1055
7 SASI_Rn01_00072481 predicted 809
8 SASI_Rn01_00072482 predicted 317
9 SASI_Rn01_00072483 predicted 1724
10 SASI_Rn02_00270554 predicted 284
11 SASI_Rn01_00072474 predicted 1387
12 SASI_Rn01_00072475 predicted 1506
13 SASI_Rn01_00072476 predicted 1579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034004 predicted 1191
2 SASI_Mm01_00034005 predicted 280
3 SASI_Mm01_00034006 predicted 615
4 SASI_Mm01_00034007 predicted 471
5 SASI_Mm02_00348915 predicted 1075
6 SASI_Mm01_00034008 predicted 770
7 SASI_Mm01_00034012 predicted 401
8 SASI_Mm01_00034009 predicted 1066
9 SASI_Mm01_00034011 predicted 954
10 SASI_Mm02_00348916 predicted 1305
11 SASI_Mm01_00034003 predicted 1373
12 SASI_Mm01_00034010 predicted 1146
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178592
VALIDATED
ABHD16A MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 16A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-1631s1c1
Sequence:CCGGCGGAAGCATCTACACAACTTTCTCGAGAAAGTTGTGTAGATGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-274s1c1
Sequence:CCGGCTACTTATACAGGAAAGGTTACTCGAGTAACCTTTCCTGTATAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-1471s1c1
Sequence:CCGGGCTAGAGGAAGCCTCCATTTACTCGAGTAAATGGAGGCTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-1138s1c1
Sequence:CCGGCCCAGACATCAGTGCTGTTATCTCGAGATAACAGCACTGATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-761s1c1
Sequence:CCGGCGACTGGTGGAAGAGTGTAATCTCGAGATTACACTCTTCCACCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178592.3-158s21c1
Sequence:CCGGAGCTCCTGGGATACGTATTATCTCGAGATAATACGTATCCCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178592.3-1726s21c1
Sequence:CCGGTCTTCTGGAAGGACAAGATAGCTCGAGCTATCTTGTCCTTCCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178592.3-323s21c1
Sequence:CCGGTCTCACTATGCCGGGACATTGCTCGAGCAATGTCCCGGCATAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178592.3-232s21c1
Sequence:CCGGCTTCTGGTCCATCTCTTATTACTCGAGTAATAAGAGATGGACCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178592.3-462s21c1
Sequence:CCGGAGAGGCAGCTGGCCAACTATACTCGAGTATAGTTGGCCAGCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178592
VALIDATED
ABHD16A MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 16A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-1631s1c1
Sequence:CCGGCGGAAGCATCTACACAACTTTCTCGAGAAAGTTGTGTAGATGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-274s1c1
Sequence:CCGGCTACTTATACAGGAAAGGTTACTCGAGTAACCTTTCCTGTATAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-1471s1c1
Sequence:CCGGGCTAGAGGAAGCCTCCATTTACTCGAGTAAATGGAGGCTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-1138s1c1
Sequence:CCGGCCCAGACATCAGTGCTGTTATCTCGAGATAACAGCACTGATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-761s1c1
Sequence:CCGGCGACTGGTGGAAGAGTGTAATCTCGAGATTACACTCTTCCACCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178592.3-158s21c1
Sequence:CCGGAGCTCCTGGGATACGTATTATCTCGAGATAATACGTATCCCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178592.3-1726s21c1
Sequence:CCGGTCTTCTGGAAGGACAAGATAGCTCGAGCTATCTTGTCCTTCCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178592.3-323s21c1
Sequence:CCGGTCTCACTATGCCGGGACATTGCTCGAGCAATGTCCCGGCATAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178592.3-232s21c1
Sequence:CCGGCTTCTGGTCCATCTCTTATTACTCGAGTAATAAGAGATGGACCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178592.3-462s21c1
Sequence:CCGGAGAGGCAGCTGGCCAACTATACTCGAGTATAGTTGGCCAGCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178592
VALIDATED
ABHD16A MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 16A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-1631s1c1
Sequence:CCGGCGGAAGCATCTACACAACTTTCTCGAGAAAGTTGTGTAGATGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-274s1c1
Sequence:CCGGCTACTTATACAGGAAAGGTTACTCGAGTAACCTTTCCTGTATAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-1471s1c1
Sequence:CCGGGCTAGAGGAAGCCTCCATTTACTCGAGTAAATGGAGGCTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-1138s1c1
Sequence:CCGGCCCAGACATCAGTGCTGTTATCTCGAGATAACAGCACTGATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178592.2-761s1c1
Sequence:CCGGCGACTGGTGGAAGAGTGTAATCTCGAGATTACACTCTTCCACCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178592.3-158s21c1
Sequence:CCGGAGCTCCTGGGATACGTATTATCTCGAGATAATACGTATCCCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178592.3-1726s21c1
Sequence:CCGGTCTTCTGGAAGGACAAGATAGCTCGAGCTATCTTGTCCTTCCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178592.3-323s21c1
Sequence:CCGGTCTCACTATGCCGGGACATTGCTCGAGCAATGTCCCGGCATAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178592.3-232s21c1
Sequence:CCGGCTTCTGGTCCATCTCTTATTACTCGAGTAATAAGAGATGGACCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178592.3-462s21c1
Sequence:CCGGAGAGGCAGCTGGCCAACTATACTCGAGTATAGTTGGCCAGCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021160
VALIDATED
ABHD16A MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 16A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021160.1-1242s1c1
Sequence:CCGGGCAGCATCTCAATCTAAACAACTCGAGTTGTTTAGATTGAGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021160.1-1467s1c1
Sequence:CCGGGCTGGAGGAAGCCTCAATTTACTCGAGTAAATTGAGGCTTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021160.1-328s1c1
Sequence:CCGGGCTGGGACATTGCTGCTACTTCTCGAGAAGTAGCAGCAATGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021160.1-1124s1c1
Sequence:CCGGCCATGTCCTACCCAGATGTTACTCGAGTAACATCTGGGTAGGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021160.1-402s1c1
Sequence:CCGGCCGGCAGTTCATCACCATCTTCTCGAGAAGATGGTGATGAACTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021160.1-1707s21c1
Sequence:CCGGGGGACCAACTGGGACTCATTACTCGAGTAATGAGTCCCAGTTGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021160.1-228s21c1
Sequence:CCGGATTCTGGTCCATCTCTTATTACTCGAGTAATAAGAGATGGACCAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021160.1-1784s21c1
Sequence:CCGGGTGTTCATGTTGCTGTTTATACTCGAGTATAAACAGCAACATGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021160.1-275s21c1
Sequence:CCGGTGTACAGGAAAGGTTACTTGACTCGAGTCAAGTAACCTTTCCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021160.1-1309s21c1
Sequence:CCGGAGAACCAAGGATGAGATCATCCTCGAGGATGATCTCATCCTTGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021160
VALIDATED
ABHD16A MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 16A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021160.1-1242s1c1
Sequence:CCGGGCAGCATCTCAATCTAAACAACTCGAGTTGTTTAGATTGAGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021160.1-1467s1c1
Sequence:CCGGGCTGGAGGAAGCCTCAATTTACTCGAGTAAATTGAGGCTTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021160.1-328s1c1
Sequence:CCGGGCTGGGACATTGCTGCTACTTCTCGAGAAGTAGCAGCAATGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021160.1-1124s1c1
Sequence:CCGGCCATGTCCTACCCAGATGTTACTCGAGTAACATCTGGGTAGGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021160.1-402s1c1
Sequence:CCGGCCGGCAGTTCATCACCATCTTCTCGAGAAGATGGTGATGAACTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021160.1-1707s21c1
Sequence:CCGGGGGACCAACTGGGACTCATTACTCGAGTAATGAGTCCCAGTTGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021160.1-228s21c1
Sequence:CCGGATTCTGGTCCATCTCTTATTACTCGAGTAATAAGAGATGGACCAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021160.1-1784s21c1
Sequence:CCGGGTGTTCATGTTGCTGTTTATACTCGAGTATAAACAGCAACATGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021160.1-275s21c1
Sequence:CCGGTGTACAGGAAAGGTTACTTGACTCGAGTCAAGTAACCTTTCCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021160.1-1309s21c1
Sequence:CCGGAGAACCAAGGATGAGATCATCCTCGAGGATGATCTCATCCTTGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021160
VALIDATED
ABHD16A MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 16A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021160.1-1242s1c1
Sequence:CCGGGCAGCATCTCAATCTAAACAACTCGAGTTGTTTAGATTGAGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021160.1-1467s1c1
Sequence:CCGGGCTGGAGGAAGCCTCAATTTACTCGAGTAAATTGAGGCTTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021160.1-328s1c1
Sequence:CCGGGCTGGGACATTGCTGCTACTTCTCGAGAAGTAGCAGCAATGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021160.1-1124s1c1
Sequence:CCGGCCATGTCCTACCCAGATGTTACTCGAGTAACATCTGGGTAGGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021160.1-402s1c1
Sequence:CCGGCCGGCAGTTCATCACCATCTTCTCGAGAAGATGGTGATGAACTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021160.1-1707s21c1
Sequence:CCGGGGGACCAACTGGGACTCATTACTCGAGTAATGAGTCCCAGTTGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021160.1-228s21c1
Sequence:CCGGATTCTGGTCCATCTCTTATTACTCGAGTAATAAGAGATGGACCAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021160.1-1784s21c1
Sequence:CCGGGTGTTCATGTTGCTGTTTATACTCGAGTATAAACAGCAACATGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021160.1-275s21c1
Sequence:CCGGTGTACAGGAAAGGTTACTTGACTCGAGTCAAGTAACCTTTCCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021160.1-1309s21c1
Sequence:CCGGAGAACCAAGGATGAGATCATCCTCGAGGATGATCTCATCCTTGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks