EMAIL THIS PAGE TO A FRIEND

ABHD16B

abhydrolase domain containing 16B

41 Gene Product Result for
Synonyms: C20orf135 dJ591C20.1
UniProtKB ID: Q9H3Z7
Gene ID:
Mouse(241850) abhydrolase domain containing 16B
Rat(311720) abhydrolase domain containing 16B
naked mole-rat(101711980) abhydrolase domain containing 16B
domestic guinea pig(100729038) abhydrolase domain containing 16B
sheep(101116851) abhydrolase domain containing 16B
cow(514829) abhydrolase domain containing 16B
domestic cat(101095244) abhydrolase domain containing 16B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183181 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183181 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183181 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080622 Rosetta Predictions human pricing
NM_001014052 Rosetta Predictions rat pricing
NM_183181 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149831 predicted 770
2 SASI_Hs01_00149832 predicted 992
3 SASI_Hs01_00149833 predicted 838
4 SASI_Hs01_00149834 predicted 779
5 SASI_Hs01_00149835 predicted 360
6 SASI_Hs02_00362369 predicted 844
7 SASI_Hs01_00149836 predicted 758
8 SASI_Hs01_00149837 predicted 709
9 SASI_Hs01_00149838 predicted 1477
10 SASI_Hs01_00149839 predicted 1058
11 SASI_Hs01_00149830 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048844 predicted 949
2 SASI_Rn01_00048845 predicted 753
3 SASI_Rn01_00048846 predicted 1173
4 SASI_Rn01_00048847 predicted 943
5 SASI_Rn01_00048848 predicted 1649
6 SASI_Rn01_00048849 predicted 1651
7 SASI_Rn01_00048850 predicted 893
8 SASI_Rn01_00048851 predicted 1673
9 SASI_Rn01_00048852 predicted 1220
10 SASI_Rn01_00048853 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141384 predicted 763
2 SASI_Mm02_00350289 predicted 615
3 SASI_Mm01_00141385 predicted 1498
4 SASI_Mm01_00141386 predicted 815
5 SASI_Mm01_00141387 predicted 431
6 SASI_Mm01_00141388 predicted 548
7 SASI_Mm01_00141389 predicted 1506
8 SASI_Mm01_00141390 predicted 1524
9 SASI_Mm01_00141391 predicted 1526
10 SASI_Mm01_00141392 predicted 1274
11 SASI_Mm01_00141393 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080622
ABHD16B MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 16B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080622.3-875s21c1
Sequence:CCGGTTCTACGAGATGGGCTGTCTGCTCGAGCAGACAGCCCATCTCGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080622.3-1290s21c1
Sequence:CCGGAGGATGACGTGGTCAGCACTTCTCGAGAAGTGCTGACCACGTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-453s1c1
Sequence:CCGGCGAGATCGACACTATGTTCATCTCGAGATGAACATAGTGTCGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-57s1c1
Sequence:CCGGCGCCAGCTACACCTACCCATTCTCGAGAATGGGTAGGTGTAGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-447s1c1
Sequence:CCGGCGGCAACGAGATCGACACTATCTCGAGATAGTGTCGATCTCGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-519s1c1
Sequence:CCGGCGTCATCTGCTGCGAAGGCAACTCGAGTTGCCTTCGCAGCAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-885s1c1
Sequence:CCGGGCGCGAGCACTTCAACCTCAACTCGAGTTGAGGTTGAAGTGCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080622
ABHD16B MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 16B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080622.3-875s21c1
Sequence:CCGGTTCTACGAGATGGGCTGTCTGCTCGAGCAGACAGCCCATCTCGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080622.3-1290s21c1
Sequence:CCGGAGGATGACGTGGTCAGCACTTCTCGAGAAGTGCTGACCACGTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-453s1c1
Sequence:CCGGCGAGATCGACACTATGTTCATCTCGAGATGAACATAGTGTCGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-57s1c1
Sequence:CCGGCGCCAGCTACACCTACCCATTCTCGAGAATGGGTAGGTGTAGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-447s1c1
Sequence:CCGGCGGCAACGAGATCGACACTATCTCGAGATAGTGTCGATCTCGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-519s1c1
Sequence:CCGGCGTCATCTGCTGCGAAGGCAACTCGAGTTGCCTTCGCAGCAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-885s1c1
Sequence:CCGGGCGCGAGCACTTCAACCTCAACTCGAGTTGAGGTTGAAGTGCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080622
ABHD16B MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 16B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080622.3-875s21c1
Sequence:CCGGTTCTACGAGATGGGCTGTCTGCTCGAGCAGACAGCCCATCTCGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080622.3-1290s21c1
Sequence:CCGGAGGATGACGTGGTCAGCACTTCTCGAGAAGTGCTGACCACGTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-453s1c1
Sequence:CCGGCGAGATCGACACTATGTTCATCTCGAGATGAACATAGTGTCGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-57s1c1
Sequence:CCGGCGCCAGCTACACCTACCCATTCTCGAGAATGGGTAGGTGTAGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-447s1c1
Sequence:CCGGCGGCAACGAGATCGACACTATCTCGAGATAGTGTCGATCTCGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-519s1c1
Sequence:CCGGCGTCATCTGCTGCGAAGGCAACTCGAGTTGCCTTCGCAGCAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080622.1-885s1c1
Sequence:CCGGGCGCGAGCACTTCAACCTCAACTCGAGTTGAGGTTGAAGTGCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183181
ABHD16B MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 16B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-1160s1c1
Sequence:CCGGCGCCTTCTACAGCACAGATATCTCGAGATATCTGTGCTGTAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-764s1c1
Sequence:CCGGGCAATGGATGTAGTGGTCAAACTCGAGTTTGACCACTACATCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-130s1c1
Sequence:CCGGGCACGTGTTCAAGATCTACTTCTCGAGAAGTAGATCTTGAACACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-989s1c1
Sequence:CCGGGAACACTTCAATCTCAATGTTCTCGAGAACATTGAGATTGAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-1293s1c1
Sequence:CCGGGCTTAGCAACACTTCGTTCTTCTCGAGAAGAACGAAGTGTTGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183181
ABHD16B MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 16B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-1160s1c1
Sequence:CCGGCGCCTTCTACAGCACAGATATCTCGAGATATCTGTGCTGTAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-764s1c1
Sequence:CCGGGCAATGGATGTAGTGGTCAAACTCGAGTTTGACCACTACATCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-130s1c1
Sequence:CCGGGCACGTGTTCAAGATCTACTTCTCGAGAAGTAGATCTTGAACACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-989s1c1
Sequence:CCGGGAACACTTCAATCTCAATGTTCTCGAGAACATTGAGATTGAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-1293s1c1
Sequence:CCGGGCTTAGCAACACTTCGTTCTTCTCGAGAAGAACGAAGTGTTGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183181
ABHD16B MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 16B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-1160s1c1
Sequence:CCGGCGCCTTCTACAGCACAGATATCTCGAGATATCTGTGCTGTAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-764s1c1
Sequence:CCGGGCAATGGATGTAGTGGTCAAACTCGAGTTTGACCACTACATCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-130s1c1
Sequence:CCGGGCACGTGTTCAAGATCTACTTCTCGAGAAGTAGATCTTGAACACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-989s1c1
Sequence:CCGGGAACACTTCAATCTCAATGTTCTCGAGAACATTGAGATTGAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183181.1-1293s1c1
Sequence:CCGGGCTTAGCAACACTTCGTTCTTCTCGAGAAGAACGAAGTGTTGCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks