EMAIL THIS PAGE TO A FRIEND

ABHD17A

abhydrolase domain containing 17A

60 Gene Product Result for
Synonyms: C19orf27 FAM108A1
Gene ID:
Mouse(216169) abhydrolase domain containing 17A
Rat(299617) abhydrolase domain containing 17A
cow(614425) family with sequence similarity 108, member A1
domestic guinea pig(100733633) abhydrolase domain containing 17A
naked mole-rat(101721456) abhydrolase domain containing 17A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031213 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116041 MISSION® esiRNA esiRNA human FAM108A5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031213 Rosetta Predictions human pricing
NM_001006983 Rosetta Predictions rat pricing
NM_145421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243705 predicted 782
2 SASI_Hs02_00358619 predicted 1153
3 SASI_Hs02_00358620 predicted 1318
4 SASI_Hs02_00358621 predicted 792
5 SASI_Hs02_00358622 predicted 1016
6 SASI_Hs02_00358623 predicted 998
7 SASI_Hs02_00358624 predicted 1069
8 SASI_Hs02_00358625 predicted 802
9 SASI_Hs02_00358626 predicted 1000
10 SASI_Hs02_00358627 predicted 1147
11 SASI_Hs01_00243706 predicted 649
12 SASI_Hs01_00243707 predicted 416
13 SASI_Hs01_00243708 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046864 predicted 1180
2 SASI_Rn01_00046865 predicted 911
3 SASI_Rn02_00198554 predicted 810
4 SASI_Rn01_00046867 predicted 871
5 SASI_Rn01_00046868 predicted 1003
6 SASI_Rn01_00046869 predicted 1178
7 SASI_Rn01_00046871 predicted 863
8 SASI_Rn01_00046872 predicted 877
9 SASI_Rn01_00046873 predicted 1087
10 SASI_Rn02_00198555 predicted 919
11 SASI_Rn01_00046866 predicted 1023
12 SASI_Rn01_00046870 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115506 predicted 424
2 SASI_Mm02_00340769 predicted 657
3 SASI_Mm01_00115507 predicted 866
4 SASI_Mm01_00115508 predicted 1035
5 SASI_Mm01_00115509 predicted 1002
6 SASI_Mm01_00115510 predicted 1171
7 SASI_Mm01_00115511 predicted 1082
8 SASI_Mm01_00115512 predicted 1179
9 SASI_Mm01_00115513 predicted 1004
10 SASI_Mm02_00340770 predicted 852
11 SASI_Mm01_00115505 predicted 812
12 SASI_Mm01_00115514 predicted 878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031213
ABHD17A MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 17A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-1145s1c1
Sequence:CCGGCACCAAGAAGACCTACTGCTTCTCGAGAAGCAGTAGGTCTTCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-887s1c1
Sequence:CCGGCCACTGCAACATCTTCTCCTACTCGAGTAGGAGAAGATGTTGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-848s1c1
Sequence:CCGGCCAGATGAGCAGCTTCTACATCTCGAGATGTAGAAGCTGCTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-777s1c1
Sequence:CCGGGCCTGCGGGTACATCCACCTTCTCGAGAAGGTGGATGTACCCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-790s1c1
Sequence:CCGGTCCACCTTCTCGCCAGGTACACTCGAGTGTACCTGGCGAGAAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-1417s21c1
Sequence:CCGGCATCGAGCTCTACAGCCAGTACTCGAGTACTGGCTGTAGAGCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-707s21c1
Sequence:CCGGTGCATGTATGTTCGCTGCGTGCTCGAGCACGCAGCGAACATACATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-1408s21c1
Sequence:CCGGGCACAACGACATCGAGCTCTACTCGAGTAGAGCTCGATGTCGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031213.3-1640s21c1
Sequence:CCGGACAGAGCTACGCACTCCTTTCCTCGAGGAAAGGAGTGCGTAGCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-1275s21c1
Sequence:CCGGAGGTGTCCAAGATCACGTCTCCTCGAGGAGACGTGATCTTGGACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-981s21c1
Sequence:CCGGACATCTTCTCCTACGACTACTCTCGAGAGTAGTCGTAGGAGAAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-698s21c1
Sequence:CCGGCGCGTCTCCTGCATGTATGTTCTCGAGAACATACATGCAGGAGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031213.3-1625s21c1
Sequence:CCGGGACGATGTACAGGCAACAGAGCTCGAGCTCTGTTGCCTGTACATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031213
ABHD17A MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 17A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-1145s1c1
Sequence:CCGGCACCAAGAAGACCTACTGCTTCTCGAGAAGCAGTAGGTCTTCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-887s1c1
Sequence:CCGGCCACTGCAACATCTTCTCCTACTCGAGTAGGAGAAGATGTTGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-848s1c1
Sequence:CCGGCCAGATGAGCAGCTTCTACATCTCGAGATGTAGAAGCTGCTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-777s1c1
Sequence:CCGGGCCTGCGGGTACATCCACCTTCTCGAGAAGGTGGATGTACCCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-790s1c1
Sequence:CCGGTCCACCTTCTCGCCAGGTACACTCGAGTGTACCTGGCGAGAAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-1417s21c1
Sequence:CCGGCATCGAGCTCTACAGCCAGTACTCGAGTACTGGCTGTAGAGCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-707s21c1
Sequence:CCGGTGCATGTATGTTCGCTGCGTGCTCGAGCACGCAGCGAACATACATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-1408s21c1
Sequence:CCGGGCACAACGACATCGAGCTCTACTCGAGTAGAGCTCGATGTCGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031213.3-1640s21c1
Sequence:CCGGACAGAGCTACGCACTCCTTTCCTCGAGGAAAGGAGTGCGTAGCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-1275s21c1
Sequence:CCGGAGGTGTCCAAGATCACGTCTCCTCGAGGAGACGTGATCTTGGACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-981s21c1
Sequence:CCGGACATCTTCTCCTACGACTACTCTCGAGAGTAGTCGTAGGAGAAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-698s21c1
Sequence:CCGGCGCGTCTCCTGCATGTATGTTCTCGAGAACATACATGCAGGAGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031213.3-1625s21c1
Sequence:CCGGGACGATGTACAGGCAACAGAGCTCGAGCTCTGTTGCCTGTACATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031213
ABHD17A MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 17A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-1145s1c1
Sequence:CCGGCACCAAGAAGACCTACTGCTTCTCGAGAAGCAGTAGGTCTTCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-887s1c1
Sequence:CCGGCCACTGCAACATCTTCTCCTACTCGAGTAGGAGAAGATGTTGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-848s1c1
Sequence:CCGGCCAGATGAGCAGCTTCTACATCTCGAGATGTAGAAGCTGCTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-777s1c1
Sequence:CCGGGCCTGCGGGTACATCCACCTTCTCGAGAAGGTGGATGTACCCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031213.2-790s1c1
Sequence:CCGGTCCACCTTCTCGCCAGGTACACTCGAGTGTACCTGGCGAGAAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-1417s21c1
Sequence:CCGGCATCGAGCTCTACAGCCAGTACTCGAGTACTGGCTGTAGAGCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-707s21c1
Sequence:CCGGTGCATGTATGTTCGCTGCGTGCTCGAGCACGCAGCGAACATACATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-1408s21c1
Sequence:CCGGGCACAACGACATCGAGCTCTACTCGAGTAGAGCTCGATGTCGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031213.3-1640s21c1
Sequence:CCGGACAGAGCTACGCACTCCTTTCCTCGAGGAAAGGAGTGCGTAGCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-1275s21c1
Sequence:CCGGAGGTGTCCAAGATCACGTCTCCTCGAGGAGACGTGATCTTGGACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-981s21c1
Sequence:CCGGACATCTTCTCCTACGACTACTCTCGAGAGTAGTCGTAGGAGAAGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031213.3-698s21c1
Sequence:CCGGCGCGTCTCCTGCATGTATGTTCTCGAGAACATACATGCAGGAGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031213.3-1625s21c1
Sequence:CCGGGACGATGTACAGGCAACAGAGCTCGAGCTCTGTTGCCTGTACATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145421
VALIDATED
ABHD17A MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 17A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145421.1-1016s1c1
Sequence:CCGGCTTCGATGCTTTCCCTAACATCTCGAGATGTTAGGGAAAGCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145421.1-803s1c1
Sequence:CCGGGAAGAACCTCTATGCTGACATCTCGAGATGTCAGCATAGAGGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145421.1-1184s1c1
Sequence:CCGGCATTGAGCTGTACAGTCAATACTCGAGTATTGACTGTACAGCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145421.1-666s1c1
Sequence:CCGGGTTCTCTTCTCGCATGGCAATCTCGAGATTGCCATGCGAGAAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145421.1-572s1c1
Sequence:CCGGGCTGGATACCATCGAGGTCTTCTCGAGAAGACCTCGATGGTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145421.1-803s21c1
Sequence:CCGGGAAGAACCTCTATGCTGACATCTCGAGATGTCAGCATAGAGGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145421.1-1034s21c1
Sequence:CCGGCATCGAGAAGGTGTCGAAGATCTCGAGATCTTCGACACCTTCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145421.1-700s21c1
Sequence:CCGGGCCAGATGTGCAGCTTCTATGCTCGAGCATAGAAGCTGCACATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145421.1-1267s21c1
Sequence:CCGGGCAGGGACCTCAGCAGTACATCTCGAGATGTACTGCTGAGGTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145421
VALIDATED
ABHD17A MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 17A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145421.1-1016s1c1
Sequence:CCGGCTTCGATGCTTTCCCTAACATCTCGAGATGTTAGGGAAAGCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145421.1-803s1c1
Sequence:CCGGGAAGAACCTCTATGCTGACATCTCGAGATGTCAGCATAGAGGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145421.1-1184s1c1
Sequence:CCGGCATTGAGCTGTACAGTCAATACTCGAGTATTGACTGTACAGCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145421.1-666s1c1
Sequence:CCGGGTTCTCTTCTCGCATGGCAATCTCGAGATTGCCATGCGAGAAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145421.1-572s1c1
Sequence:CCGGGCTGGATACCATCGAGGTCTTCTCGAGAAGACCTCGATGGTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145421.1-803s21c1
Sequence:CCGGGAAGAACCTCTATGCTGACATCTCGAGATGTCAGCATAGAGGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145421.1-1034s21c1
Sequence:CCGGCATCGAGAAGGTGTCGAAGATCTCGAGATCTTCGACACCTTCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145421.1-700s21c1
Sequence:CCGGGCCAGATGTGCAGCTTCTATGCTCGAGCATAGAAGCTGCACATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145421.1-1267s21c1
Sequence:CCGGGCAGGGACCTCAGCAGTACATCTCGAGATGTACTGCTGAGGTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145421
VALIDATED
ABHD17A MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 17A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145421.1-1016s1c1
Sequence:CCGGCTTCGATGCTTTCCCTAACATCTCGAGATGTTAGGGAAAGCATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145421.1-803s1c1
Sequence:CCGGGAAGAACCTCTATGCTGACATCTCGAGATGTCAGCATAGAGGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145421.1-1184s1c1
Sequence:CCGGCATTGAGCTGTACAGTCAATACTCGAGTATTGACTGTACAGCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145421.1-666s1c1
Sequence:CCGGGTTCTCTTCTCGCATGGCAATCTCGAGATTGCCATGCGAGAAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145421.1-572s1c1
Sequence:CCGGGCTGGATACCATCGAGGTCTTCTCGAGAAGACCTCGATGGTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145421.1-803s21c1
Sequence:CCGGGAAGAACCTCTATGCTGACATCTCGAGATGTCAGCATAGAGGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145421.1-1034s21c1
Sequence:CCGGCATCGAGAAGGTGTCGAAGATCTCGAGATCTTCGACACCTTCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145421.1-700s21c1
Sequence:CCGGGCCAGATGTGCAGCTTCTATGCTCGAGCATAGAAGCTGCACATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145421.1-1267s21c1
Sequence:CCGGGCAGGGACCTCAGCAGTACATCTCGAGATGTACTGCTGAGGTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks