EMAIL THIS PAGE TO A FRIEND

ABHD17B

abhydrolase domain containing 17B

118 Gene Product Result for
Synonyms: C9orf77 FAM108B1 RP11-409O11.2
UniProtKB ID: Q5VST6, A8KAJ5, Q5VST7, Q86YB6, Q8IY03, Q9Y377
Gene ID:
Mouse(226016) abhydrolase domain containing 17B
Rat(309399) abhydrolase domain containing 17B
Zebrafish(437017) abhydrolase domain containing 17B
chicken(427252) family with sequence similarity 108, member B1
naked mole-rat(101711471) abhydrolase domain containing 17B
domestic guinea pig(100727408) abhydrolase domain containing 17B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047862 Anti-ABHD17B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2100746 Anti-FAM108B1 antibody produced in rabbit affinity isolated antibody bovine, human, canine, mouse, guinea pig, rabbit, horse, zebrafish, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146096 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146096 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146096 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016014 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025780 Rosetta Predictions human pricing
NM_016014 Rosetta Predictions human pricing
NM_001014028 Rosetta Predictions rat pricing
NM_146096 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048610 predicted 819
2 SASI_Hs01_00048612 predicted 897
3 SASI_Hs01_00048613 predicted 1032
4 SASI_Hs01_00048614 predicted 1200
5 SASI_Hs01_00048615 predicted 1086
6 SASI_Hs01_00048616 predicted 1127
7 SASI_Hs01_00048617 predicted 811
8 SASI_Hs01_00048618 predicted 795
9 SASI_Hs01_00048619 predicted 698
10 SASI_Hs02_00307488 predicted 847
11 SASI_Hs01_00048611 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209800 predicted 814
2 SASI_Hs01_00209802 predicted 896
3 SASI_Hs01_00209803 predicted 1028
4 SASI_Hs01_00209804 predicted 1207
5 SASI_Hs01_00209805 predicted 1085
6 SASI_Hs01_00209806 predicted 1129
7 SASI_Hs01_00209807 predicted 812
8 SASI_Hs01_00209808 predicted 791
9 SASI_Hs01_00209809 predicted 702
10 SASI_Hs02_00348697 predicted 851
11 SASI_Hs01_00209801 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037688 predicted 412
2 SASI_Rn01_00037689 predicted 1093
3 SASI_Rn01_00037690 predicted 843
4 SASI_Rn01_00037691 predicted 1070
5 SASI_Rn01_00037692 predicted 537
6 SASI_Rn01_00037693 predicted 384
7 SASI_Rn01_00037694 predicted 520
8 SASI_Rn01_00037695 predicted 647
9 SASI_Rn01_00037696 predicted 654
10 SASI_Rn01_00037697 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341735 predicted 451
2 SASI_Mm01_00178965 predicted 519
3 SASI_Mm01_00178966 predicted 1094
4 SASI_Mm02_00341736 predicted 582
5 SASI_Mm01_00178967 predicted 558
6 SASI_Mm01_00178968 predicted 628
7 SASI_Mm01_00178969 predicted 669
8 SASI_Mm01_00178970 predicted 651
9 SASI_Mm01_00178971 predicted 514
10 SASI_Mm01_00178972 predicted 942
11 SASI_Mm01_00178973 predicted 1095
12 SASI_Mm01_00178974 predicted 900
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146096
VALIDATED
ABHD17B MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 17B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146096.3-1616s21c1
Sequence:CCGGACATCCAAATTGAGTTGATATCTCGAGATATCAACTCAATTTGGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146096.3-1199s21c1
Sequence:CCGGACTGCACTCCTTGGTAAATAACTCGAGTTATTTACCAAGGAGTGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146096.3-557s21c1
Sequence:CCGGCTAAGTATACCTTACTCTTCTCTCGAGAGAAGAGTAAGGTATACTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146096.2-367s1c1
Sequence:CCGGCCCGCATTAATTGTAACATATCTCGAGATATGTTACAATTAATGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146096.2-818s1c1
Sequence:CCGGCGTGGAGCTTTATGGACAATACTCGAGTATTGTCCATAAAGCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146096.2-96s1c1
Sequence:CCGGCTAGCATTCTTGCCACCTGATCTCGAGATCAGGTGGCAAGAATGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146096.2-428s1c1
Sequence:CCGGGCCAACAGAGAAGAACCTGTACTCGAGTACAGGTTCTTCTCTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146096.2-657s1c1
Sequence:CCGGGCATTCCCAAACATTGACAAACTCGAGTTTGTCAATGTTTGGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146096
VALIDATED
ABHD17B MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 17B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146096.3-1616s21c1
Sequence:CCGGACATCCAAATTGAGTTGATATCTCGAGATATCAACTCAATTTGGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000450128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146096.3-1199s21c1
Sequence:CCGGACTGCACTCCTTGGTAAATAACTCGAGTTATTTACCAAGGAGTGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146096.3-557s21c1
Sequence:CCGGCTAAGTATACCTTACTCTTCTCTCGAGAGAAGAGTAAGGTATACTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146096.2-367s1c1
Sequence:CCGGCCCGCATTAATTGTAACATATCTCGAGATATGTTACAATTAATGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146096.2-818s1c1
Sequence:CCGGCGTGGAGCTTTATGGACAATACTCGAGTATTGTCCATAAAGCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146096.2-96s1c1
Sequence:CCGGCTAGCATTCTTGCCACCTGATCTCGAGATCAGGTGGCAAGAATGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146096.2-428s1c1
Sequence:CCGGGCCAACAGAGAAGAACCTGTACTCGAGTACAGGTTCTTCTCTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146096.2-657s1c1
Sequence:CCGGGCATTCCCAAACATTGACAAACTCGAGTTTGTCAATGTTTGGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146096
VALIDATED
ABHD17B MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 17B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146096.3-1616s21c1
Sequence:CCGGACATCCAAATTGAGTTGATATCTCGAGATATCAACTCAATTTGGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146096.3-1199s21c1
Sequence:CCGGACTGCACTCCTTGGTAAATAACTCGAGTTATTTACCAAGGAGTGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146096.3-557s21c1
Sequence:CCGGCTAAGTATACCTTACTCTTCTCTCGAGAGAAGAGTAAGGTATACTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146096.2-367s1c1
Sequence:CCGGCCCGCATTAATTGTAACATATCTCGAGATATGTTACAATTAATGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146096.2-818s1c1
Sequence:CCGGCGTGGAGCTTTATGGACAATACTCGAGTATTGTCCATAAAGCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146096.2-96s1c1
Sequence:CCGGCTAGCATTCTTGCCACCTGATCTCGAGATCAGGTGGCAAGAATGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146096.2-428s1c1
Sequence:CCGGGCCAACAGAGAAGAACCTGTACTCGAGTACAGGTTCTTCTCTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146096.2-657s1c1
Sequence:CCGGGCATTCCCAAACATTGACAAACTCGAGTTTGTCAATGTTTGGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016014
ABHD17B MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 17B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016014.2-939s21c1
Sequence:CCGGGGACTAGGATCACGGATTAATCTCGAGATTAATCCGTGATCCTAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016014.2-1131s21c1
Sequence:CCGGGTGGATCTTGCTGCTCGATATCTCGAGATATCGAGCAGCAAGATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-1098s1c1
Sequence:CCGGGTGGAACTTTATGGACAGTATCTCGAGATACTGTCCATAAAGTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-392s1c1
Sequence:CCGGTGATCCAACTTACACACTGATCTCGAGATCAGTGTGTAAGTTGGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-609s1c1
Sequence:CCGGCTTGGTCAAATGAGCAGCTTTCTCGAGAAAGCTGCTCATTTGACCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-755s1c1
Sequence:CCGGTCTTAGGACAAGATATGGCATCTCGAGATGCCATATCTTGTCCTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-1032s1c1
Sequence:CCGGGCATTGTTTGAACGTTGCCAACTCGAGTTGGCAACGTTCAAACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016014
ABHD17B MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 17B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016014.2-939s21c1
Sequence:CCGGGGACTAGGATCACGGATTAATCTCGAGATTAATCCGTGATCCTAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016014.2-1131s21c1
Sequence:CCGGGTGGATCTTGCTGCTCGATATCTCGAGATATCGAGCAGCAAGATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-1098s1c1
Sequence:CCGGGTGGAACTTTATGGACAGTATCTCGAGATACTGTCCATAAAGTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-392s1c1
Sequence:CCGGTGATCCAACTTACACACTGATCTCGAGATCAGTGTGTAAGTTGGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-609s1c1
Sequence:CCGGCTTGGTCAAATGAGCAGCTTTCTCGAGAAAGCTGCTCATTTGACCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-755s1c1
Sequence:CCGGTCTTAGGACAAGATATGGCATCTCGAGATGCCATATCTTGTCCTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-1032s1c1
Sequence:CCGGGCATTGTTTGAACGTTGCCAACTCGAGTTGGCAACGTTCAAACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016014
ABHD17B MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 17B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016014.2-939s21c1
Sequence:CCGGGGACTAGGATCACGGATTAATCTCGAGATTAATCCGTGATCCTAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016014.2-1131s21c1
Sequence:CCGGGTGGATCTTGCTGCTCGATATCTCGAGATATCGAGCAGCAAGATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-1098s1c1
Sequence:CCGGGTGGAACTTTATGGACAGTATCTCGAGATACTGTCCATAAAGTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-392s1c1
Sequence:CCGGTGATCCAACTTACACACTGATCTCGAGATCAGTGTGTAAGTTGGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-609s1c1
Sequence:CCGGCTTGGTCAAATGAGCAGCTTTCTCGAGAAAGCTGCTCATTTGACCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-755s1c1
Sequence:CCGGTCTTAGGACAAGATATGGCATCTCGAGATGCCATATCTTGTCCTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016014.1-1032s1c1
Sequence:CCGGGCATTGTTTGAACGTTGCCAACTCGAGTTGGCAACGTTCAAACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)