EMAIL THIS PAGE TO A FRIEND

ABHD17C

abhydrolase domain containing 17C

50 Gene Product Result for
Synonyms: FAM108C1
UniProtKB ID: Q6PCB6, Q1RMD6, Q9NPM1
Gene ID:
Mouse(70178) abhydrolase domain containing 17C
Rat(361601) abhydrolase domain containing 17C
domestic guinea pig(100727981) abhydrolase domain containing 17C
Zebrafish(393126) abhydrolase domain containing 17C
chicken(415479) family with sequence similarity 108, member C1
cow(520956) family with sequence similarity 108, member C1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021214 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032921 MISSION® esiRNA esiRNA human FAM108C1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021214 Rosetta Predictions human pricing
XM_051862 Rosetta Predictions human pricing
NM_001100736 Rosetta Predictions rat pricing
NM_133722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354811 predicted 1239
2 SASI_Hs02_00354812 predicted 733
3 SASI_Hs02_00354813 predicted 1163
4 SASI_Hs02_00354814 predicted 1036
5 SASI_Hs02_00354815 predicted 1279
6 SASI_Hs02_00354816 predicted 1076
7 SASI_Hs02_00354817 predicted 1358
8 SASI_Hs02_00354818 predicted 1116
9 SASI_Hs02_00354819 predicted 780
10 SASI_Hs02_00354820 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_051862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282669 predicted 1647
2 SASI_Hs01_00282670 predicted 1136
3 SASI_Hs01_00282671 predicted 1569
4 SASI_Hs01_00282672 predicted 1451
5 SASI_Hs01_00282673 predicted 1689
6 SASI_Hs01_00282674 predicted 1484
7 SASI_Hs01_00282675 predicted 1761
8 SASI_Hs01_00282676 predicted 1533
9 SASI_Hs01_00282677 predicted 1445
10 SASI_Hs01_00282678 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210418 predicted 453
2 SASI_Rn02_00210419 predicted 1043
3 SASI_Rn02_00210420 predicted 1045
4 SASI_Rn02_00210421 predicted 922
5 SASI_Rn02_00210422 predicted 910
6 SASI_Rn02_00210423 predicted 946
7 SASI_Rn02_00210424 predicted 1024
8 SASI_Rn02_00210425 predicted 756
9 SASI_Rn02_00210426 predicted 1011
10 SASI_Rn02_00210427 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143207 predicted 1081
2 SASI_Mm01_00143208 predicted 1447
3 SASI_Mm01_00143209 predicted 1064
4 SASI_Mm01_00143210 predicted 456
5 SASI_Mm01_00143211 predicted 947
6 SASI_Mm01_00143212 predicted 1436
7 SASI_Mm01_00143213 predicted 945
8 SASI_Mm01_00143214 predicted 1338
9 SASI_Mm01_00143215 predicted 979
10 SASI_Mm01_00143216 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133722
VALIDATED
ABHD17C MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 17C
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133722.1-1062s1c1
Sequence:CCGGGCACACGCTTTGACTGGATTTCTCGAGAAATCCAGTCAAAGCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133722.1-493s1c1
Sequence:CCGGGCGCATCAACTGCAACATCTTCTCGAGAAGATGTTGCAGTTGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133722.1-956s1c1
Sequence:CCGGGCACAGTACCTAGAACGACTACTCGAGTAGTCGTTCTAGGTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133722.1-626s1c1
Sequence:CCGGCCTGAGAACATCATCCTCTATCTCGAGATAGAGGATGATGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133722.2-493s21c1
Sequence:CCGGGCGCATCAACTGCAACATCTTCTCGAGAAGATGTTGCAGTTGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133722.2-1062s21c1
Sequence:CCGGGCACACGCTTTGACTGGATTTCTCGAGAAATCCAGTCAAAGCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133722.2-956s21c1
Sequence:CCGGGCACAGTACCTAGAACGACTACTCGAGTAGTCGTTCTAGGTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133722.2-626s21c1
Sequence:CCGGCCTGAGAACATCATCCTCTATCTCGAGATAGAGGATGATGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133722
VALIDATED
ABHD17C MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 17C
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133722.1-1062s1c1
Sequence:CCGGGCACACGCTTTGACTGGATTTCTCGAGAAATCCAGTCAAAGCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133722.1-493s1c1
Sequence:CCGGGCGCATCAACTGCAACATCTTCTCGAGAAGATGTTGCAGTTGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133722.1-956s1c1
Sequence:CCGGGCACAGTACCTAGAACGACTACTCGAGTAGTCGTTCTAGGTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133722.1-626s1c1
Sequence:CCGGCCTGAGAACATCATCCTCTATCTCGAGATAGAGGATGATGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133722.2-493s21c1
Sequence:CCGGGCGCATCAACTGCAACATCTTCTCGAGAAGATGTTGCAGTTGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133722.2-1062s21c1
Sequence:CCGGGCACACGCTTTGACTGGATTTCTCGAGAAATCCAGTCAAAGCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133722.2-956s21c1
Sequence:CCGGGCACAGTACCTAGAACGACTACTCGAGTAGTCGTTCTAGGTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133722.2-626s21c1
Sequence:CCGGCCTGAGAACATCATCCTCTATCTCGAGATAGAGGATGATGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133722
VALIDATED
ABHD17C MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 17C
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133722.1-1062s1c1
Sequence:CCGGGCACACGCTTTGACTGGATTTCTCGAGAAATCCAGTCAAAGCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133722.1-493s1c1
Sequence:CCGGGCGCATCAACTGCAACATCTTCTCGAGAAGATGTTGCAGTTGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133722.1-956s1c1
Sequence:CCGGGCACAGTACCTAGAACGACTACTCGAGTAGTCGTTCTAGGTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133722.1-626s1c1
Sequence:CCGGCCTGAGAACATCATCCTCTATCTCGAGATAGAGGATGATGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133722.2-493s21c1
Sequence:CCGGGCGCATCAACTGCAACATCTTCTCGAGAAGATGTTGCAGTTGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133722.2-1062s21c1
Sequence:CCGGGCACACGCTTTGACTGGATTTCTCGAGAAATCCAGTCAAAGCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133722.2-956s21c1
Sequence:CCGGGCACAGTACCTAGAACGACTACTCGAGTAGTCGTTCTAGGTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133722.2-626s21c1
Sequence:CCGGCCTGAGAACATCATCCTCTATCTCGAGATAGAGGATGATGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021214
VALIDATED
ABHD17C MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 17C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_021214.1-715s21c1
Sequence:CCGGGCGTGAGTCCCGAGAACATTACTCGAGTAATGTTCTCGGGACTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021214.1-789s21c1
Sequence:CCGGTATGAATGCGCAGCGGTAATTCTCGAGAATTACCGCTGCGCATTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021214.1-888s21c1
Sequence:CCGGAGCATTGACAAGATATCTAAACTCGAGTTTAGATATCTTGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_021214.1-1659s21c1
Sequence:CCGGCATCAACTGTAACCATATAAACTCGAGTTTATATGGTTACAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021214.1-942s21c1
Sequence:CCGGGAGGATGAGGTCATCGATTTCCTCGAGGAAATCGATGACCTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021214
VALIDATED
ABHD17C MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 17C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_021214.1-715s21c1
Sequence:CCGGGCGTGAGTCCCGAGAACATTACTCGAGTAATGTTCTCGGGACTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021214.1-789s21c1
Sequence:CCGGTATGAATGCGCAGCGGTAATTCTCGAGAATTACCGCTGCGCATTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021214.1-888s21c1
Sequence:CCGGAGCATTGACAAGATATCTAAACTCGAGTTTAGATATCTTGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_021214.1-1659s21c1
Sequence:CCGGCATCAACTGTAACCATATAAACTCGAGTTTATATGGTTACAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021214.1-942s21c1
Sequence:CCGGGAGGATGAGGTCATCGATTTCCTCGAGGAAATCGATGACCTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021214
VALIDATED
ABHD17C MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 17C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_021214.1-715s21c1
Sequence:CCGGGCGTGAGTCCCGAGAACATTACTCGAGTAATGTTCTCGGGACTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021214.1-789s21c1
Sequence:CCGGTATGAATGCGCAGCGGTAATTCTCGAGAATTACCGCTGCGCATTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021214.1-888s21c1
Sequence:CCGGAGCATTGACAAGATATCTAAACTCGAGTTTAGATATCTTGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_021214.1-1659s21c1
Sequence:CCGGCATCAACTGTAACCATATAAACTCGAGTTTATATGGTTACAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021214.1-942s21c1
Sequence:CCGGGAGGATGAGGTCATCGATTTCCTCGAGGAAATCGATGACCTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks