EMAIL THIS PAGE TO A FRIEND

ABHD1

abhydrolase domain containing 1

100 Gene Product Result for
Synonyms: LABH1
UniProtKB ID: Q96SE0, Q05BY3, Q53SZ1, Q8IXQ7
Gene ID:
Human(84696) Summary: This gene is a member of the AB hydrolase superfamily and encodes a protein with an alpha/beta hydrolase fold. This domain is common to a number of hydrolytic enzymes of widely differing phylogenetic origins and catalytic functions. [provided by RefSeq, Jul 2008]
Mouse(57742) abhydrolase domain containing 1
Rat(313917) abhydrolase domain containing 1
domestic cat(101101558) abhydrolase domain containing 1
cow(510774) abhydrolase domain containing 1
dog(100685411) abhydrolase domain containing 1
naked mole-rat(101708016) abhydrolase domain containing 1
domestic guinea pig(100726028) abhydrolase domain containing 1
sheep(101114505) abhydrolase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032604 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021304 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021304 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021304 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU062381 MISSION® esiRNA esiRNA targeting mouse Abhd1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032604 Rosetta Predictions human pricing
NM_001008520 Rosetta Predictions rat pricing
NM_021304 Rosetta Predictions mouse pricing
NR_003522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243749 predicted 931
2 SASI_Hs01_00243750 predicted 608
3 SASI_Hs01_00243751 predicted 494
4 SASI_Hs01_00243752 predicted 886
5 SASI_Hs02_00360154 predicted 1057
6 SASI_Hs01_00243754 predicted 676
7 SASI_Hs01_00243755 predicted 998
8 SASI_Hs01_00243756 predicted 571
9 SASI_Hs01_00243757 predicted 568
10 SASI_Hs01_00243758 predicted 1011
11 SASI_Hs01_00243753 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052470 predicted 215
2 SASI_Rn01_00052471 predicted 974
3 SASI_Rn01_00052472 predicted 571
4 SASI_Rn01_00052473 predicted 961
5 SASI_Rn01_00052474 predicted 676
6 SASI_Rn01_00052475 predicted 757
7 SASI_Rn01_00052476 predicted 233
8 SASI_Rn01_00052477 predicted 893
9 SASI_Rn01_00052478 predicted 875
10 SASI_Rn01_00052479 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107168 predicted 540
2 SASI_Mm01_00107169 predicted 639
3 SASI_Mm01_00107170 predicted 432
4 SASI_Mm01_00107171 predicted 720
5 SASI_Mm01_00107172 predicted 815
6 SASI_Mm01_00107173 predicted 420
7 SASI_Mm01_00107174 predicted 1057
8 SASI_Mm01_00107175 predicted 845
9 SASI_Mm01_00107176 predicted 703
10 SASI_Mm01_00107177 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353427 predicted 573
2 SASI_Mm02_00353428 predicted 677
3 SASI_Mm02_00353429 predicted 473
4 SASI_Mm02_00353430 predicted 734
5 SASI_Mm02_00353431 predicted 756
6 SASI_Mm02_00353432 predicted 860
7 SASI_Mm02_00353433 predicted 465
8 SASI_Mm02_00353434 predicted 1101
9 SASI_Mm02_00353435 predicted 887
10 SASI_Mm02_00353436 predicted 928
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032604
ABHD1 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032604.3-894s21c1
Sequence:CCGGTCAACTCACTGCTCTTCAATCCTCGAGGATTGAAGAGCAGTGAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032604.3-1083s21c1
Sequence:CCGGCAAGCCCTAGAACCAAGATAGCTCGAGCTATCTTGGTTCTAGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032604.3-612s21c1
Sequence:CCGGGCTACCAGGCTGTCGTGTTTACTCGAGTAAACACGACAGCCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032604.2-1001s1c1
Sequence:CCGGGCCCGTACAATCCGCCAGTTTCTCGAGAAACTGGCGGATTGTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032604.2-377s1c1
Sequence:CCGGCGACTACAAAGCATCTTCCAACTCGAGTTGGAAGATGCTTTGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032604.2-1286s1c1
Sequence:CCGGCTCTTGCATCAGTACGCCAAACTCGAGTTTGGCGTACTGATGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032604.2-565s1c1
Sequence:CCGGCCAGGATACATACGTCTTGCACTCGAGTGCAAGACGTATGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032604
ABHD1 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032604.3-894s21c1
Sequence:CCGGTCAACTCACTGCTCTTCAATCCTCGAGGATTGAAGAGCAGTGAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032604.3-1083s21c1
Sequence:CCGGCAAGCCCTAGAACCAAGATAGCTCGAGCTATCTTGGTTCTAGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032604.3-612s21c1
Sequence:CCGGGCTACCAGGCTGTCGTGTTTACTCGAGTAAACACGACAGCCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032604.2-1001s1c1
Sequence:CCGGGCCCGTACAATCCGCCAGTTTCTCGAGAAACTGGCGGATTGTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032604.2-377s1c1
Sequence:CCGGCGACTACAAAGCATCTTCCAACTCGAGTTGGAAGATGCTTTGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032604.2-1286s1c1
Sequence:CCGGCTCTTGCATCAGTACGCCAAACTCGAGTTTGGCGTACTGATGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032604.2-565s1c1
Sequence:CCGGCCAGGATACATACGTCTTGCACTCGAGTGCAAGACGTATGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032604
ABHD1 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032604.3-894s21c1
Sequence:CCGGTCAACTCACTGCTCTTCAATCCTCGAGGATTGAAGAGCAGTGAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032604.3-1083s21c1
Sequence:CCGGCAAGCCCTAGAACCAAGATAGCTCGAGCTATCTTGGTTCTAGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032604.3-612s21c1
Sequence:CCGGGCTACCAGGCTGTCGTGTTTACTCGAGTAAACACGACAGCCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032604.2-1001s1c1
Sequence:CCGGGCCCGTACAATCCGCCAGTTTCTCGAGAAACTGGCGGATTGTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032604.2-377s1c1
Sequence:CCGGCGACTACAAAGCATCTTCCAACTCGAGTTGGAAGATGCTTTGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032604.2-1286s1c1
Sequence:CCGGCTCTTGCATCAGTACGCCAAACTCGAGTTTGGCGTACTGATGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032604.2-565s1c1
Sequence:CCGGCCAGGATACATACGTCTTGCACTCGAGTGCAAGACGTATGTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021304
ABHD1 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021304.3-646s21c1
Sequence:CCGGGGATACTGGTGCTTAACTATCCTCGAGGATAGTTAAGCACCAGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021304.3-763s21c1
Sequence:CCGGTCAACTCACTGCTCTTCAATCCTCGAGGATTGAAGAGCAGTGAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021304.3-542s21c1
Sequence:CCGGGGCTTACTGTGCCAGCAATACCTCGAGGTATTGCTGGCACAGTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021304.2-1163s1c1
Sequence:CCGGCCTGGCAACACTGTTACATGACTCGAGTCATGTAACAGTGTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021304.2-489s1c1
Sequence:CCGGCCTAGTTAACCAAGCTCTGAACTCGAGTTCAGAGCTTGGTTAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-743s1c1
Sequence:CCGGCCATGTCTGCATGTTGGGATTCTCGAGAATCCCAACATGCAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-1189s1c1
Sequence:CCGGGTACTACATCAGTATGCCCGACTCGAGTCGGGCATACTGATGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-526s1c1
Sequence:CCGGGTTGTATTTAATAACCGAGGACTCGAGTCCTCGGTTATTAAATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-607s1c1
Sequence:CCGGGAAACAGTTGTGAAGCACATACTCGAGTATGTGCTTCACAACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-879s1c1
Sequence:CCGGGTTGGATGTAGACTTTGCGATCTCGAGATCGCAAAGTCTACATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021304
ABHD1 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021304.3-646s21c1
Sequence:CCGGGGATACTGGTGCTTAACTATCCTCGAGGATAGTTAAGCACCAGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021304.3-763s21c1
Sequence:CCGGTCAACTCACTGCTCTTCAATCCTCGAGGATTGAAGAGCAGTGAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021304.3-542s21c1
Sequence:CCGGGGCTTACTGTGCCAGCAATACCTCGAGGTATTGCTGGCACAGTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021304.2-1163s1c1
Sequence:CCGGCCTGGCAACACTGTTACATGACTCGAGTCATGTAACAGTGTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021304.2-489s1c1
Sequence:CCGGCCTAGTTAACCAAGCTCTGAACTCGAGTTCAGAGCTTGGTTAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-743s1c1
Sequence:CCGGCCATGTCTGCATGTTGGGATTCTCGAGAATCCCAACATGCAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-1189s1c1
Sequence:CCGGGTACTACATCAGTATGCCCGACTCGAGTCGGGCATACTGATGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-526s1c1
Sequence:CCGGGTTGTATTTAATAACCGAGGACTCGAGTCCTCGGTTATTAAATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-607s1c1
Sequence:CCGGGAAACAGTTGTGAAGCACATACTCGAGTATGTGCTTCACAACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-879s1c1
Sequence:CCGGGTTGGATGTAGACTTTGCGATCTCGAGATCGCAAAGTCTACATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021304
ABHD1 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021304.3-646s21c1
Sequence:CCGGGGATACTGGTGCTTAACTATCCTCGAGGATAGTTAAGCACCAGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021304.3-763s21c1
Sequence:CCGGTCAACTCACTGCTCTTCAATCCTCGAGGATTGAAGAGCAGTGAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021304.3-542s21c1
Sequence:CCGGGGCTTACTGTGCCAGCAATACCTCGAGGTATTGCTGGCACAGTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021304.2-1163s1c1
Sequence:CCGGCCTGGCAACACTGTTACATGACTCGAGTCATGTAACAGTGTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021304.2-489s1c1
Sequence:CCGGCCTAGTTAACCAAGCTCTGAACTCGAGTTCAGAGCTTGGTTAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-743s1c1
Sequence:CCGGCCATGTCTGCATGTTGGGATTCTCGAGAATCCCAACATGCAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-1189s1c1
Sequence:CCGGGTACTACATCAGTATGCCCGACTCGAGTCGGGCATACTGATGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-526s1c1
Sequence:CCGGGTTGTATTTAATAACCGAGGACTCGAGTCCTCGGTTATTAAATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-607s1c1
Sequence:CCGGGAAACAGTTGTGAAGCACATACTCGAGTATGTGCTTCACAACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021304.2-879s1c1
Sequence:CCGGGTTGGATGTAGACTTTGCGATCTCGAGATCGCAAAGTCTACATCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks