EMAIL THIS PAGE TO A FRIEND

ABHD2

abhydrolase domain containing 2

215 Gene Product Result for
Synonyms: HS1-2 LABH2 PHPS1-2
UniProtKB ID: P08910, Q53G48, Q53GU0, Q5FVD9, Q8TC79
Gene ID:
Human(11057) Summary: This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a very wide range of enzymes. The function of this protein has not been determined. Alternative splicing of this gene results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(54608) abhydrolase domain containing 2
Rat(293050) abhydrolase domain containing 2
chicken(415493) abhydrolase domain containing 2
domestic cat(101084288) abhydrolase domain containing 2
cow(508717) abhydrolase domain containing 2
Horse(100053880) abhydrolase domain containing 2
dog(479037) abhydrolase domain containing 2
naked mole-rat(101698752) abhydrolase domain containing 2
domestic guinea pig(100729472) abhydrolase domain containing 2
sheep(101103014) abhydrolase domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA005999 Anti-ABHD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103165 Anti-ABHD2 antibody produced in rabbit affinity isolated antibody bovine, mouse, rabbit, guinea pig, canine, human, horse, rat, zebrafish
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007011 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007011 Rosetta Predictions human pricing
NM_152924 Rosetta Predictions human pricing
NM_001106275 Rosetta Predictions rat pricing
NM_018811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151280 predicted 1737
2 SASI_Hs02_00342769 predicted 1237
3 SASI_Hs01_00151281 predicted 1941
4 SASI_Hs02_00342770 predicted 1956
5 SASI_Hs01_00151282 predicted 1178
6 SASI_Hs01_00151283 predicted 1095
7 SASI_Hs01_00151284 predicted 1757
8 SASI_Hs01_00151285 predicted 1792
9 SASI_Hs01_00151286 predicted 1831
10 SASI_Hs01_00151287 predicted 1600
11 SASI_Hs01_00151278 predicted 1864
12 SASI_Hs01_00151279 predicted 1507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039647 predicted 1337
2 SASI_Hs02_00366920 predicted 838
3 SASI_Hs01_00039648 predicted 1545
4 SASI_Hs02_00366921 predicted 1563
5 SASI_Hs01_00039649 predicted 782
6 SASI_Hs01_00039650 predicted 700
7 SASI_Hs01_00039651 predicted 1363
8 SASI_Hs01_00039652 predicted 1392
9 SASI_Hs01_00039653 predicted 1437
10 SASI_Hs01_00039654 predicted 1197
11 SASI_Hs01_00039645 predicted 1467
12 SASI_Hs01_00039646 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217368 predicted 850
2 SASI_Rn02_00217369 predicted 1149
3 SASI_Rn02_00217370 predicted 448
4 SASI_Rn02_00217371 predicted 1425
5 SASI_Rn02_00217372 predicted 409
6 SASI_Rn02_00217373 predicted 1016
7 SASI_Rn02_00217374 predicted 1275
8 SASI_Rn02_00217375 predicted 1044
9 SASI_Rn02_00217376 predicted 523
10 SASI_Rn02_00217377 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089055 predicted 1096
2 SASI_Mm01_00089056 predicted 1382
3 SASI_Mm01_00089057 predicted 799
4 SASI_Mm01_00089058 predicted 401
5 SASI_Mm01_00089059 predicted 1044
6 SASI_Mm01_00089060 predicted 1169
7 SASI_Mm01_00089061 predicted 1061
8 SASI_Mm01_00089062 predicted 1146
9 SASI_Mm01_00089064 predicted 366
10 SASI_Mm02_00324150 predicted 1081
11 SASI_Mm01_00089063 predicted 1234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007011
VALIDATED
ABHD2 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-996s21c1
Sequence:CCGGTACGTGATCGTCCGGTGTTTGCTCGAGCAAACACCGGACGATCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1841s21c1
Sequence:CCGGGAGGAAGTTTCACGGCTATAACTCGAGTTATAGCCGTGAAACTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1334s21c1
Sequence:CCGGGAAGCAATACATCCGCACTTTCTCGAGAAAGTGCGGATGTATTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007011.6-2485s21c1
Sequence:CCGGACATCTAGTTTCCCTATTAAACTCGAGTTTAATAGGGAAACTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1534s21c1
Sequence:CCGGTCAGCCTGGGTGGTAACATTGCTCGAGCAATGTTACCACCCAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1949s21c1
Sequence:CCGGCGATCCGTTGGTGCATGAAAGCTCGAGCTTTCATGCACCAACGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1899s21c1
Sequence:CCGGCGGTACCTGCACAGGATTTATCTCGAGATAAATCCTGTGCAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007011.4-1434s1c1
Sequence:CCGGGCGGTTCTACAACTTCCTCATCTCGAGATGAGGAAGTTGTAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007011.4-963s1c1
Sequence:CCGGGCACCGGAAGTTCATCACTATCTCGAGATAGTGATGAACTTCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_007011.4-1884s1c1
Sequence:CCGGCATTTGCCAATGGGAGCGTAACTCGAGTTACGCTCCCATTGGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007011.4-1657s1c1
Sequence:CCGGCGGTACCTGCACAGGATTTATCTCGAGATAAATCCTGTGCAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007011
VALIDATED
ABHD2 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-996s21c1
Sequence:CCGGTACGTGATCGTCCGGTGTTTGCTCGAGCAAACACCGGACGATCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1841s21c1
Sequence:CCGGGAGGAAGTTTCACGGCTATAACTCGAGTTATAGCCGTGAAACTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1334s21c1
Sequence:CCGGGAAGCAATACATCCGCACTTTCTCGAGAAAGTGCGGATGTATTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007011.6-2485s21c1
Sequence:CCGGACATCTAGTTTCCCTATTAAACTCGAGTTTAATAGGGAAACTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1534s21c1
Sequence:CCGGTCAGCCTGGGTGGTAACATTGCTCGAGCAATGTTACCACCCAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1949s21c1
Sequence:CCGGCGATCCGTTGGTGCATGAAAGCTCGAGCTTTCATGCACCAACGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1899s21c1
Sequence:CCGGCGGTACCTGCACAGGATTTATCTCGAGATAAATCCTGTGCAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007011.4-1434s1c1
Sequence:CCGGGCGGTTCTACAACTTCCTCATCTCGAGATGAGGAAGTTGTAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007011.4-963s1c1
Sequence:CCGGGCACCGGAAGTTCATCACTATCTCGAGATAGTGATGAACTTCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_007011.4-1884s1c1
Sequence:CCGGCATTTGCCAATGGGAGCGTAACTCGAGTTACGCTCCCATTGGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007011.4-1657s1c1
Sequence:CCGGCGGTACCTGCACAGGATTTATCTCGAGATAAATCCTGTGCAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007011
VALIDATED
ABHD2 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-996s21c1
Sequence:CCGGTACGTGATCGTCCGGTGTTTGCTCGAGCAAACACCGGACGATCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1841s21c1
Sequence:CCGGGAGGAAGTTTCACGGCTATAACTCGAGTTATAGCCGTGAAACTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1334s21c1
Sequence:CCGGGAAGCAATACATCCGCACTTTCTCGAGAAAGTGCGGATGTATTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007011.6-2485s21c1
Sequence:CCGGACATCTAGTTTCCCTATTAAACTCGAGTTTAATAGGGAAACTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1534s21c1
Sequence:CCGGTCAGCCTGGGTGGTAACATTGCTCGAGCAATGTTACCACCCAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1949s21c1
Sequence:CCGGCGATCCGTTGGTGCATGAAAGCTCGAGCTTTCATGCACCAACGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007011.6-1899s21c1
Sequence:CCGGCGGTACCTGCACAGGATTTATCTCGAGATAAATCCTGTGCAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007011.4-1434s1c1
Sequence:CCGGGCGGTTCTACAACTTCCTCATCTCGAGATGAGGAAGTTGTAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007011.4-963s1c1
Sequence:CCGGGCACCGGAAGTTCATCACTATCTCGAGATAGTGATGAACTTCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_007011.4-1884s1c1
Sequence:CCGGCATTTGCCAATGGGAGCGTAACTCGAGTTACGCTCCCATTGGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007011.4-1657s1c1
Sequence:CCGGCGGTACCTGCACAGGATTTATCTCGAGATAAATCCTGTGCAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018811
VALIDATED
ABHD2 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018811.4-1953s1c1
Sequence:CCGGGCCTGTGAAACAAAGGAAATTCTCGAGAATTTCCTTTGTTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018811.4-1119s1c1
Sequence:CCGGGCTATAATTCCCTGAAGGAATCTCGAGATTCCTTCAGGGAATTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018811.4-1345s1c1
Sequence:CCGGGCCGCTGACATGGATGGATAACTCGAGTTATCCATCCATGTCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018811.4-1129s1c1
Sequence:CCGGCCTGAAGGAATACTATGAGGACTCGAGTCCTCATAGTATTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018811.4-589s1c1
Sequence:CCGGCCACAGCGAGAAGCAGTATATCTCGAGATATACTGCTTCTCGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018811
VALIDATED
ABHD2 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018811.4-1953s1c1
Sequence:CCGGGCCTGTGAAACAAAGGAAATTCTCGAGAATTTCCTTTGTTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018811.4-1119s1c1
Sequence:CCGGGCTATAATTCCCTGAAGGAATCTCGAGATTCCTTCAGGGAATTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018811.4-1345s1c1
Sequence:CCGGGCCGCTGACATGGATGGATAACTCGAGTTATCCATCCATGTCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018811.4-1129s1c1
Sequence:CCGGCCTGAAGGAATACTATGAGGACTCGAGTCCTCATAGTATTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018811.4-589s1c1
Sequence:CCGGCCACAGCGAGAAGCAGTATATCTCGAGATATACTGCTTCTCGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018811
VALIDATED
ABHD2 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121482    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018811.4-1953s1c1
Sequence:CCGGGCCTGTGAAACAAAGGAAATTCTCGAGAATTTCCTTTGTTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018811.4-1119s1c1
Sequence:CCGGGCTATAATTCCCTGAAGGAATCTCGAGATTCCTTCAGGGAATTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018811.4-1345s1c1
Sequence:CCGGGCCGCTGACATGGATGGATAACTCGAGTTATCCATCCATGTCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018811.4-1129s1c1
Sequence:CCGGCCTGAAGGAATACTATGAGGACTCGAGTCCTCATAGTATTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018811.4-589s1c1
Sequence:CCGGCCACAGCGAGAAGCAGTATATCTCGAGATATACTGCTTCTCGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks