EMAIL THIS PAGE TO A FRIEND

ABHD3

abhydrolase domain containing 3

107 Gene Product Result for
Synonyms: LABH3
UniProtKB ID: Q8WU67, B0YIV0, O43411
Gene ID:
Human(171586) Summary: This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a very wide range of enzymes. The function of this protein has not been determined. [provided by RefSeq, Jul 2008]
Mouse(106861) abhydrolase domain containing 3
Rat(291793) abhydrolase domain containing 3
Zebrafish(447830) abhydrolase domain containing 3
dog(480177) abhydrolase domain containing 3
cow(539795) abhydrolase domain containing 3
domestic cat(101095048) abhydrolase domain containing 3
chicken(421068) abhydrolase domain containing 3
sheep(101122746) abhydrolase domain containing 3
domestic guinea pig(100721630) abhydrolase domain containing 3
naked mole-rat(101716636) abhydrolase domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138340 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134130 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134130 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134130 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138340 Rosetta Predictions human pricing
NM_001106162 Rosetta Predictions rat pricing
NM_134130 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180657 predicted 1012
2 SASI_Hs01_00180659 predicted 1144
3 SASI_Hs01_00180660 predicted 999
4 SASI_Hs01_00180661 predicted 1254
5 SASI_Hs01_00180662 predicted 981
6 SASI_Hs01_00180663 predicted 1329
7 SASI_Hs01_00180664 predicted 557
8 SASI_Hs02_00363429 predicted 1090
9 SASI_Hs01_00180665 predicted 1311
10 SASI_Hs01_00180666 predicted 1104
11 SASI_Hs01_00180658 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216238 predicted 500
2 SASI_Rn02_00216239 predicted 922
3 SASI_Rn02_00216240 predicted 601
4 SASI_Rn02_00216241 predicted 970
5 SASI_Rn02_00216242 predicted 972
6 SASI_Rn02_00216243 predicted 1158
7 SASI_Rn02_00216244 predicted 1292
8 SASI_Rn02_00216245 predicted 1286
9 SASI_Rn02_00216246 predicted 1202
10 SASI_Rn02_00216247 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196259 predicted 567
2 SASI_Mm01_00196260 predicted 885
3 SASI_Mm01_00196261 predicted 1213
4 SASI_Mm02_00339374 predicted 499
5 SASI_Mm01_00196263 predicted 671
6 SASI_Mm01_00196264 predicted 933
7 SASI_Mm01_00196265 predicted 1140
8 SASI_Mm02_00339375 predicted 1291
9 SASI_Mm01_00196266 predicted 830
10 SASI_Mm02_00339376 predicted 1156
11 SASI_Mm01_00196262 predicted 473
12 SASI_Mm01_00196267 predicted 1165
13 SASI_Mm01_00196268 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138340
ABHD3 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138340.3-1018s1c1
Sequence:CCGGGCGATTCACTTCAGTCATGTTCTCGAGAACATGACTGAAGTGAATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138340.3-223s1c1
Sequence:CCGGCGTCGCTTATGCCTTCTACTACTCGAGTAGTAGAAGGCATAAGCGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138340.3-921s1c1
Sequence:CCGGGCCTTCAGTCTTCAGTTAATACTCGAGTATTAACTGAAGACTGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138340.4-1058s21c1
Sequence:CCGGGCGATTCACTTCAGTCATGTTCTCGAGAACATGACTGAAGTGAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138340.4-1897s21c1
Sequence:CCGGGCAACAAAGTTAGACTGACTTCTCGAGAAGTCAGTCTAACTTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138340.4-1289s21c1
Sequence:CCGGGCCAAGACAGTCCACTTACATCTCGAGATGTAAGTGGACTGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138340.4-263s21c1
Sequence:CCGGCGTCGCTTATGCCTTCTACTACTCGAGTAGTAGAAGGCATAAGCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138340
ABHD3 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138340.3-1018s1c1
Sequence:CCGGGCGATTCACTTCAGTCATGTTCTCGAGAACATGACTGAAGTGAATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138340.3-223s1c1
Sequence:CCGGCGTCGCTTATGCCTTCTACTACTCGAGTAGTAGAAGGCATAAGCGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138340.3-921s1c1
Sequence:CCGGGCCTTCAGTCTTCAGTTAATACTCGAGTATTAACTGAAGACTGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138340.4-1058s21c1
Sequence:CCGGGCGATTCACTTCAGTCATGTTCTCGAGAACATGACTGAAGTGAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138340.4-1897s21c1
Sequence:CCGGGCAACAAAGTTAGACTGACTTCTCGAGAAGTCAGTCTAACTTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138340.4-1289s21c1
Sequence:CCGGGCCAAGACAGTCCACTTACATCTCGAGATGTAAGTGGACTGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138340.4-263s21c1
Sequence:CCGGCGTCGCTTATGCCTTCTACTACTCGAGTAGTAGAAGGCATAAGCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138340
ABHD3 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138340.3-1018s1c1
Sequence:CCGGGCGATTCACTTCAGTCATGTTCTCGAGAACATGACTGAAGTGAATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138340.3-223s1c1
Sequence:CCGGCGTCGCTTATGCCTTCTACTACTCGAGTAGTAGAAGGCATAAGCGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138340.3-921s1c1
Sequence:CCGGGCCTTCAGTCTTCAGTTAATACTCGAGTATTAACTGAAGACTGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138340.4-1058s21c1
Sequence:CCGGGCGATTCACTTCAGTCATGTTCTCGAGAACATGACTGAAGTGAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138340.4-1897s21c1
Sequence:CCGGGCAACAAAGTTAGACTGACTTCTCGAGAAGTCAGTCTAACTTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138340.4-1289s21c1
Sequence:CCGGGCCAAGACAGTCCACTTACATCTCGAGATGTAAGTGGACTGTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138340.4-263s21c1
Sequence:CCGGCGTCGCTTATGCCTTCTACTACTCGAGTAGTAGAAGGCATAAGCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134130
ABHD3 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134130.1-1176s1c1
Sequence:CCGGGATCGAGTCTTCAAGCAATTTCTCGAGAAATTGCTTGAAGACTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191518    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134130.1-1456s1c1
Sequence:CCGGGCCTTACCAAATATGACCTTACTCGAGTAAGGTCATATTTGGTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134130.1-1217s1c1
Sequence:CCGGCGGACATGAACTCTCCAACATCTCGAGATGTTGGAGAGTTCATGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134130.1-1457s1c1
Sequence:CCGGCCTTACCAAATATGACCTTAACTCGAGTTAAGGTCATATTTGGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134130.1-680s1c1
Sequence:CCGGGCTTCTGAATTACTTGGGTAACTCGAGTTACCCAAGTAATTCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134130.1-1731s1c1
Sequence:CCGGGCAACAATGTTAGACTGACTTCTCGAGAAGTCAGTCTAACATTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134130
ABHD3 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134130.1-1176s1c1
Sequence:CCGGGATCGAGTCTTCAAGCAATTTCTCGAGAAATTGCTTGAAGACTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191518    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134130.1-1456s1c1
Sequence:CCGGGCCTTACCAAATATGACCTTACTCGAGTAAGGTCATATTTGGTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134130.1-1217s1c1
Sequence:CCGGCGGACATGAACTCTCCAACATCTCGAGATGTTGGAGAGTTCATGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134130.1-1457s1c1
Sequence:CCGGCCTTACCAAATATGACCTTAACTCGAGTTAAGGTCATATTTGGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134130.1-680s1c1
Sequence:CCGGGCTTCTGAATTACTTGGGTAACTCGAGTTACCCAAGTAATTCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134130.1-1731s1c1
Sequence:CCGGGCAACAATGTTAGACTGACTTCTCGAGAAGTCAGTCTAACATTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134130
ABHD3 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134130.1-1176s1c1
Sequence:CCGGGATCGAGTCTTCAAGCAATTTCTCGAGAAATTGCTTGAAGACTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191518    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134130.1-1456s1c1
Sequence:CCGGGCCTTACCAAATATGACCTTACTCGAGTAAGGTCATATTTGGTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134130.1-1217s1c1
Sequence:CCGGCGGACATGAACTCTCCAACATCTCGAGATGTTGGAGAGTTCATGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191006    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134130.1-1457s1c1
Sequence:CCGGCCTTACCAAATATGACCTTAACTCGAGTTAAGGTCATATTTGGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134130.1-680s1c1
Sequence:CCGGGCTTCTGAATTACTTGGGTAACTCGAGTTACCCAAGTAATTCAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134130.1-1731s1c1
Sequence:CCGGGCAACAATGTTAGACTGACTTCTCGAGAAGTCAGTCTAACATTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)