EMAIL THIS PAGE TO A FRIEND

ABHD4

abhydrolase domain containing 4

144 Gene Product Result for
Synonyms: ABH4
UniProtKB ID: Q8TB40, Q9H9E0
Gene ID:
Mouse(105501) abhydrolase domain containing 4
Rat(364380) abhydrolase domain containing 4
naked mole-rat(101706595) abhydrolase domain containing 4
domestic guinea pig(100732867) abhydrolase domain containing 4
sheep(101105755) abhydrolase domain containing 4
Zebrafish(550276) abhydrolase domain containing 4
dog(607421) abhydrolase domain containing 4
cow(509896) abhydrolase domain containing 4
domestic cat(101094269) abhydrolase domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022060 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134076 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134076 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134076 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022060 Rosetta Predictions human pricing
NM_001108866 Rosetta Predictions rat pricing
NM_134076 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113227 predicted 547
2 SASI_Hs01_00113228 predicted 823
3 SASI_Hs01_00113229 predicted 530
4 SASI_Hs01_00113230 predicted 884
5 SASI_Hs01_00113231 predicted 808
6 SASI_Hs01_00113232 predicted 766
7 SASI_Hs01_00113233 predicted 880
8 SASI_Hs01_00113234 predicted 771
9 SASI_Hs01_00113235 predicted 514
10 SASI_Hs01_00113236 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242855 predicted 932
2 SASI_Rn02_00242856 predicted 538
3 SASI_Rn02_00242857 predicted 742
4 SASI_Rn02_00242858 predicted 766
5 SASI_Rn02_00242859 predicted 461
6 SASI_Rn02_00242860 predicted 553
7 SASI_Rn02_00242861 predicted 1046
8 SASI_Rn02_00242862 predicted 1145
9 SASI_Rn02_00242863 predicted 451
10 SASI_Rn02_00242864 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048894 predicted 812
2 SASI_Mm02_00339281 predicted 1060
3 SASI_Mm01_00048895 predicted 465
4 SASI_Mm02_00339282 predicted 281
5 SASI_Mm01_00048896 predicted 979
6 SASI_Mm01_00048897 predicted 445
7 SASI_Mm02_00339283 predicted 276
8 SASI_Mm01_00048898 predicted 457
9 SASI_Mm01_00048899 predicted 253
10 SASI_Mm01_00048900 predicted 523
11 SASI_Mm01_00048893 predicted 482
12 SASI_Mm01_00048901 predicted 1011
13 SASI_Mm01_00048902 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022060
VALIDATED
ABHD4 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022060.2-525s21c1
Sequence:CCGGCACTTCTTACTCAATCAAGTACTCGAGTACTTGATTGAGTAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022060.2-736s21c1
Sequence:CCGGCCGGACTTCAAACGCAAGTTTCTCGAGAAACTTGCGTTTGAAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022060.2-885s21c1
Sequence:CCGGGCGAATTCACTTGATTCGAAACTCGAGTTTCGAATCAAGTGAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022060.2-676s21c1
Sequence:CCGGCCATTGGCTGTTCTTCGAGTACTCGAGTACTCGAAGAACAGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-738s1c1
Sequence:CCGGCCGGACTTCAAACGCAAGTTTCTCGAGAAACTTGCGTTTGAAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-678s1c1
Sequence:CCGGCCATTGGCTGTTCTTCGAGTACTCGAGTACTCGAAGAACAGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-527s1c1
Sequence:CCGGCACTTCTTACTCAATCAAGTACTCGAGTACTTGATTGAGTAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-205s1c1
Sequence:CCGGCCAGATATGTATCCCTCCCAACTCGAGTTGGGAGGGATACATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-887s1c1
Sequence:CCGGGCGAATTCACTTGATTCGAAACTCGAGTTTCGAATCAAGTGAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022060
VALIDATED
ABHD4 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022060.2-525s21c1
Sequence:CCGGCACTTCTTACTCAATCAAGTACTCGAGTACTTGATTGAGTAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022060.2-736s21c1
Sequence:CCGGCCGGACTTCAAACGCAAGTTTCTCGAGAAACTTGCGTTTGAAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022060.2-885s21c1
Sequence:CCGGGCGAATTCACTTGATTCGAAACTCGAGTTTCGAATCAAGTGAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022060.2-676s21c1
Sequence:CCGGCCATTGGCTGTTCTTCGAGTACTCGAGTACTCGAAGAACAGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-738s1c1
Sequence:CCGGCCGGACTTCAAACGCAAGTTTCTCGAGAAACTTGCGTTTGAAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-678s1c1
Sequence:CCGGCCATTGGCTGTTCTTCGAGTACTCGAGTACTCGAAGAACAGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-527s1c1
Sequence:CCGGCACTTCTTACTCAATCAAGTACTCGAGTACTTGATTGAGTAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-205s1c1
Sequence:CCGGCCAGATATGTATCCCTCCCAACTCGAGTTGGGAGGGATACATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-887s1c1
Sequence:CCGGGCGAATTCACTTGATTCGAAACTCGAGTTTCGAATCAAGTGAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022060
VALIDATED
ABHD4 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022060.2-525s21c1
Sequence:CCGGCACTTCTTACTCAATCAAGTACTCGAGTACTTGATTGAGTAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022060.2-736s21c1
Sequence:CCGGCCGGACTTCAAACGCAAGTTTCTCGAGAAACTTGCGTTTGAAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022060.2-885s21c1
Sequence:CCGGGCGAATTCACTTGATTCGAAACTCGAGTTTCGAATCAAGTGAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022060.2-676s21c1
Sequence:CCGGCCATTGGCTGTTCTTCGAGTACTCGAGTACTCGAAGAACAGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-738s1c1
Sequence:CCGGCCGGACTTCAAACGCAAGTTTCTCGAGAAACTTGCGTTTGAAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-678s1c1
Sequence:CCGGCCATTGGCTGTTCTTCGAGTACTCGAGTACTCGAAGAACAGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-527s1c1
Sequence:CCGGCACTTCTTACTCAATCAAGTACTCGAGTACTTGATTGAGTAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-205s1c1
Sequence:CCGGCCAGATATGTATCCCTCCCAACTCGAGTTGGGAGGGATACATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022060.1-887s1c1
Sequence:CCGGGCGAATTCACTTGATTCGAAACTCGAGTTTCGAATCAAGTGAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134076
VALIDATED
ABHD4 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134076.1-283s21c1
Sequence:CCGGCGCACACTTCATACCTTTGATCTCGAGATCAAAGGTATGAAGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134076.1-1529s21c1
Sequence:CCGGGTATATCCCAAGCTCTCATTGCTCGAGCAATGAGAGCTTGGGATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134076.1-702s21c1
Sequence:CCGGGGATGACACCATCTCGGAATACTCGAGTATTCCGAGATGGTGTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134076.1-816s21c1
Sequence:CCGGGCGAATCCACTTAATTCGAAACTCGAGTTTCGAATTAAGTGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134076.1-667s21c1
Sequence:CCGGCCAGACTTCAAGCGCAAGTTTCTCGAGAAACTTGCGCTTGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134076.1-1559s1c1
Sequence:CCGGGCAAGAGATAAGGGCAGGATACTCGAGTATCCTGCCCTTATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134076.1-283s1c1
Sequence:CCGGCGCACACTTCATACCTTTGATCTCGAGATCAAAGGTATGAAGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134076.1-135s1c1
Sequence:CCGGCCGTTATGTATCCCTCCCAAACTCGAGTTTGGGAGGGATACATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134076.1-667s1c1
Sequence:CCGGCCAGACTTCAAGCGCAAGTTTCTCGAGAAACTTGCGCTTGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134076.1-816s1c1
Sequence:CCGGGCGAATCCACTTAATTCGAAACTCGAGTTTCGAATTAAGTGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134076
VALIDATED
ABHD4 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134076.1-283s21c1
Sequence:CCGGCGCACACTTCATACCTTTGATCTCGAGATCAAAGGTATGAAGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134076.1-1529s21c1
Sequence:CCGGGTATATCCCAAGCTCTCATTGCTCGAGCAATGAGAGCTTGGGATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134076.1-702s21c1
Sequence:CCGGGGATGACACCATCTCGGAATACTCGAGTATTCCGAGATGGTGTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134076.1-816s21c1
Sequence:CCGGGCGAATCCACTTAATTCGAAACTCGAGTTTCGAATTAAGTGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134076.1-667s21c1
Sequence:CCGGCCAGACTTCAAGCGCAAGTTTCTCGAGAAACTTGCGCTTGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134076.1-1559s1c1
Sequence:CCGGGCAAGAGATAAGGGCAGGATACTCGAGTATCCTGCCCTTATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134076.1-283s1c1
Sequence:CCGGCGCACACTTCATACCTTTGATCTCGAGATCAAAGGTATGAAGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134076.1-135s1c1
Sequence:CCGGCCGTTATGTATCCCTCCCAAACTCGAGTTTGGGAGGGATACATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134076.1-667s1c1
Sequence:CCGGCCAGACTTCAAGCGCAAGTTTCTCGAGAAACTTGCGCTTGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134076.1-816s1c1
Sequence:CCGGGCGAATCCACTTAATTCGAAACTCGAGTTTCGAATTAAGTGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134076
VALIDATED
ABHD4 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134076.1-283s21c1
Sequence:CCGGCGCACACTTCATACCTTTGATCTCGAGATCAAAGGTATGAAGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134076.1-1529s21c1
Sequence:CCGGGTATATCCCAAGCTCTCATTGCTCGAGCAATGAGAGCTTGGGATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134076.1-702s21c1
Sequence:CCGGGGATGACACCATCTCGGAATACTCGAGTATTCCGAGATGGTGTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134076.1-816s21c1
Sequence:CCGGGCGAATCCACTTAATTCGAAACTCGAGTTTCGAATTAAGTGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134076.1-667s21c1
Sequence:CCGGCCAGACTTCAAGCGCAAGTTTCTCGAGAAACTTGCGCTTGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134076.1-1559s1c1
Sequence:CCGGGCAAGAGATAAGGGCAGGATACTCGAGTATCCTGCCCTTATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134076.1-283s1c1
Sequence:CCGGCGCACACTTCATACCTTTGATCTCGAGATCAAAGGTATGAAGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134076.1-135s1c1
Sequence:CCGGCCGTTATGTATCCCTCCCAAACTCGAGTTTGGGAGGGATACATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134076.1-667s1c1
Sequence:CCGGCCAGACTTCAAGCGCAAGTTTCTCGAGAAACTTGCGCTTGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134076.1-816s1c1
Sequence:CCGGGCGAATCCACTTAATTCGAAACTCGAGTTTCGAATTAAGTGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks