EMAIL THIS PAGE TO A FRIEND

ABHD6

abhydrolase domain containing 6

102 Gene Product Result for
UniProtKB ID: Q9BV23, B2R7Y9, Q6ZMF7
Gene ID:
Mouse(66082) abhydrolase domain containing 6
Rat(305795) abhydrolase domain containing 6
chicken(416009) abhydrolase domain containing 6
dog(484712) abhydrolase domain containing 6
cow(505283) abhydrolase domain containing 6
Horse(100057821) abhydrolase domain containing 6
domestic cat(101099621) abhydrolase domain containing 6
naked mole-rat(101709119) abhydrolase domain containing 6
domestic guinea pig(100732636) abhydrolase domain containing 6
sheep(101122635) abhydrolase domain containing 6
Domestic Rabbit(100355792) abhydrolase domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025341 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025341 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025341 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020676 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020676 Rosetta Predictions human pricing
NM_001007680 Rosetta Predictions rat pricing
NM_025341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058841 predicted 788
2 SASI_Hs02_00353665 predicted 417
3 SASI_Hs01_00058842 predicted 498
4 SASI_Hs01_00058843 predicted 765
5 SASI_Hs01_00058844 predicted 544
6 SASI_Hs01_00058845 predicted 561
7 SASI_Hs01_00058846 predicted 572
8 SASI_Hs01_00058847 predicted 1176
9 SASI_Hs01_00058848 predicted 1123
10 SASI_Hs01_00058849 predicted 932
11 SASI_Hs01_00058850 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088108 predicted 338
2 SASI_Rn01_00088110 predicted 231
3 SASI_Rn01_00088111 predicted 788
4 SASI_Rn02_00198820 predicted 925
5 SASI_Rn01_00088112 predicted 422
6 SASI_Rn01_00088113 predicted 448
7 SASI_Rn01_00088114 predicted 535
8 SASI_Rn01_00088115 predicted 785
9 SASI_Rn01_00088117 predicted 284
10 SASI_Rn02_00198821 predicted 271
11 SASI_Rn01_00088109 predicted 605
12 SASI_Rn01_00088116 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113540 predicted 232
2 SASI_Mm01_00113541 predicted 260
3 SASI_Mm01_00113542 predicted 469
4 SASI_Mm01_00113543 predicted 303
5 SASI_Mm01_00113544 predicted 470
6 SASI_Mm01_00113545 predicted 371
7 SASI_Mm01_00113546 predicted 293
8 SASI_Mm01_00113547 predicted 308
9 SASI_Mm01_00113548 predicted 145
10 SASI_Mm01_00113549 predicted 102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025341
VALIDATED
ABHD6 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 6
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025341.3-1458s21c1
Sequence:CCGGAGACATTCCTCATACATTAAACTCGAGTTTAATGTATGAGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025341.3-145s21c1
Sequence:CCGGGCCATTCCAATCCTGGCATTTCTCGAGAAATGCCAGGATTGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025341.3-251s21c1
Sequence:CCGGACGCACACCATGAGGACTATCCTCGAGGATAGTCCTCATGGTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025341.3-1542s21c1
Sequence:CCGGCTACAGGAGCTTTAGTCATTTCTCGAGAAATGACTAAAGCTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025341.3-304s21c1
Sequence:CCGGCACAAGCCATCCATCCTTATGCTCGAGCATAAGGATGGATGGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025341.3-477s21c1
Sequence:CCGGGATACATCAGTTTGTAGAATGCTCGAGCATTCTACAAACTGATGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025341.2-145s1c1
Sequence:CCGGGCCATTCCAATCCTGGCATTTCTCGAGAAATGCCAGGATTGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025341.2-873s1c1
Sequence:CCGGGCATGAGAATATGGACAAGATCTCGAGATCTTGTCCATATTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025341.2-191s1c1
Sequence:CCGGCAGCACTGATAAGAATCTATTCTCGAGAATAGATTCTTATCAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025341.2-953s1c1
Sequence:CCGGCAGACATATTAGCCAAGTCAACTCGAGTTGACTTGGCTAATATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025341.2-621s1c1
Sequence:CCGGCCTGCAGTACTCAACTGACAACTCGAGTTGTCAGTTGAGTACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025341
VALIDATED
ABHD6 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 6
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025341.3-1458s21c1
Sequence:CCGGAGACATTCCTCATACATTAAACTCGAGTTTAATGTATGAGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025341.3-145s21c1
Sequence:CCGGGCCATTCCAATCCTGGCATTTCTCGAGAAATGCCAGGATTGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025341.3-251s21c1
Sequence:CCGGACGCACACCATGAGGACTATCCTCGAGGATAGTCCTCATGGTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025341.3-1542s21c1
Sequence:CCGGCTACAGGAGCTTTAGTCATTTCTCGAGAAATGACTAAAGCTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025341.3-304s21c1
Sequence:CCGGCACAAGCCATCCATCCTTATGCTCGAGCATAAGGATGGATGGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025341.3-477s21c1
Sequence:CCGGGATACATCAGTTTGTAGAATGCTCGAGCATTCTACAAACTGATGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025341.2-145s1c1
Sequence:CCGGGCCATTCCAATCCTGGCATTTCTCGAGAAATGCCAGGATTGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025341.2-873s1c1
Sequence:CCGGGCATGAGAATATGGACAAGATCTCGAGATCTTGTCCATATTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025341.2-191s1c1
Sequence:CCGGCAGCACTGATAAGAATCTATTCTCGAGAATAGATTCTTATCAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025341.2-953s1c1
Sequence:CCGGCAGACATATTAGCCAAGTCAACTCGAGTTGACTTGGCTAATATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025341.2-621s1c1
Sequence:CCGGCCTGCAGTACTCAACTGACAACTCGAGTTGTCAGTTGAGTACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025341
VALIDATED
ABHD6 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 6
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025341.3-1458s21c1
Sequence:CCGGAGACATTCCTCATACATTAAACTCGAGTTTAATGTATGAGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025341.3-145s21c1
Sequence:CCGGGCCATTCCAATCCTGGCATTTCTCGAGAAATGCCAGGATTGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025341.3-251s21c1
Sequence:CCGGACGCACACCATGAGGACTATCCTCGAGGATAGTCCTCATGGTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025341.3-1542s21c1
Sequence:CCGGCTACAGGAGCTTTAGTCATTTCTCGAGAAATGACTAAAGCTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025341.3-304s21c1
Sequence:CCGGCACAAGCCATCCATCCTTATGCTCGAGCATAAGGATGGATGGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025341.3-477s21c1
Sequence:CCGGGATACATCAGTTTGTAGAATGCTCGAGCATTCTACAAACTGATGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025341.2-145s1c1
Sequence:CCGGGCCATTCCAATCCTGGCATTTCTCGAGAAATGCCAGGATTGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025341.2-873s1c1
Sequence:CCGGGCATGAGAATATGGACAAGATCTCGAGATCTTGTCCATATTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025341.2-191s1c1
Sequence:CCGGCAGCACTGATAAGAATCTATTCTCGAGAATAGATTCTTATCAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025341.2-953s1c1
Sequence:CCGGCAGACATATTAGCCAAGTCAACTCGAGTTGACTTGGCTAATATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025341.2-621s1c1
Sequence:CCGGCCTGCAGTACTCAACTGACAACTCGAGTTGTCAGTTGAGTACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020676
VALIDATED
ABHD6 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020676.5-1674s21c1
Sequence:CCGGCCATGAAGTCTTCAAGTTCATCTCGAGATGAACTTGAAGACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020676.5-470s21c1
Sequence:CCGGCCTGGCATTTGTGGCTTCATTCTCGAGAATGAAGCCACAAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020676.5-1115s21c1
Sequence:CCGGCCGCATCCCTCATAACAACTTCTCGAGAAGTTGTTATGAGGGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020676.5-689s21c1
Sequence:CCGGCCTTCCAAAGAACCTGCACTTCTCGAGAAGTGCAGGTTCTTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020676.4-421s1c1
Sequence:CCGGCCTGGCATTTGTGGCTTCATTCTCGAGAATGAAGCCACAAATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020676.4-1081s1c1
Sequence:CCGGCAACTTCTACCGAAAGTTGTTCTCGAGAACAACTTTCGGTAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020676.4-1625s1c1
Sequence:CCGGCCATGAAGTCTTCAAGTTCATCTCGAGATGAACTTGAAGACTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020676.4-1069s1c1
Sequence:CCGGCATCCCTCATAACAACTTCTACTCGAGTAGAAGTTGTTATGAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020676.4-748s1c1
Sequence:CCGGCCAGTTTGTAGAATGCCCGAACTCGAGTTCGGGCATTCTACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_020676.4-1066s1c1
Sequence:CCGGCCGCATCCCTCATAACAACTTCTCGAGAAGTTGTTATGAGGGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020676.4-640s1c1
Sequence:CCGGCCTTCCAAAGAACCTGCACTTCTCGAGAAGTGCAGGTTCTTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020676
VALIDATED
ABHD6 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020676.5-1674s21c1
Sequence:CCGGCCATGAAGTCTTCAAGTTCATCTCGAGATGAACTTGAAGACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020676.5-470s21c1
Sequence:CCGGCCTGGCATTTGTGGCTTCATTCTCGAGAATGAAGCCACAAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020676.5-1115s21c1
Sequence:CCGGCCGCATCCCTCATAACAACTTCTCGAGAAGTTGTTATGAGGGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020676.5-689s21c1
Sequence:CCGGCCTTCCAAAGAACCTGCACTTCTCGAGAAGTGCAGGTTCTTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020676.4-421s1c1
Sequence:CCGGCCTGGCATTTGTGGCTTCATTCTCGAGAATGAAGCCACAAATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020676.4-1081s1c1
Sequence:CCGGCAACTTCTACCGAAAGTTGTTCTCGAGAACAACTTTCGGTAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020676.4-1625s1c1
Sequence:CCGGCCATGAAGTCTTCAAGTTCATCTCGAGATGAACTTGAAGACTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020676.4-1069s1c1
Sequence:CCGGCATCCCTCATAACAACTTCTACTCGAGTAGAAGTTGTTATGAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020676.4-748s1c1
Sequence:CCGGCCAGTTTGTAGAATGCCCGAACTCGAGTTCGGGCATTCTACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_020676.4-1066s1c1
Sequence:CCGGCCGCATCCCTCATAACAACTTCTCGAGAAGTTGTTATGAGGGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020676.4-640s1c1
Sequence:CCGGCCTTCCAAAGAACCTGCACTTCTCGAGAAGTGCAGGTTCTTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020676
VALIDATED
ABHD6 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020676.5-1674s21c1
Sequence:CCGGCCATGAAGTCTTCAAGTTCATCTCGAGATGAACTTGAAGACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020676.5-470s21c1
Sequence:CCGGCCTGGCATTTGTGGCTTCATTCTCGAGAATGAAGCCACAAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020676.5-1115s21c1
Sequence:CCGGCCGCATCCCTCATAACAACTTCTCGAGAAGTTGTTATGAGGGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020676.5-689s21c1
Sequence:CCGGCCTTCCAAAGAACCTGCACTTCTCGAGAAGTGCAGGTTCTTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_020676.4-421s1c1
Sequence:CCGGCCTGGCATTTGTGGCTTCATTCTCGAGAATGAAGCCACAAATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020676.4-1081s1c1
Sequence:CCGGCAACTTCTACCGAAAGTTGTTCTCGAGAACAACTTTCGGTAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020676.4-1625s1c1
Sequence:CCGGCCATGAAGTCTTCAAGTTCATCTCGAGATGAACTTGAAGACTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020676.4-1069s1c1
Sequence:CCGGCATCCCTCATAACAACTTCTACTCGAGTAGAAGTTGTTATGAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020676.4-748s1c1
Sequence:CCGGCCAGTTTGTAGAATGCCCGAACTCGAGTTCGGGCATTCTACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_020676.4-1066s1c1
Sequence:CCGGCCGCATCCCTCATAACAACTTCTCGAGAAGTTGTTATGAGGGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020676.4-640s1c1
Sequence:CCGGCCTTCCAAAGAACCTGCACTTCTCGAGAAGTGCAGGTTCTTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks