EMAIL THIS PAGE TO A FRIEND

ABHD8

abhydrolase domain containing 8

53 Gene Product Result for
UniProtKB ID: Q96I13, Q9HAE9
Gene ID:
Human(79575) Summary: This gene is upstream of, and in a head-to-head orientation with the gene for the mitochondrial ribosomal protein L34. The predicted protein contains alpha/beta hydrolase fold and secretory lipase domains. [provided by RefSeq, Jul 2008]
Mouse(64296) abhydrolase domain containing 8
Rat(306338) abhydrolase domain containing 8
Zebrafish(558563) abhydrolase domain containing 8
dog(484840) abhydrolase domain containing 8
Horse(100070083) abhydrolase domain containing 8
cow(768306) abhydrolase domain containing 8
domestic cat(101096295) abhydrolase domain containing 8
chicken(100857580) abhydrolase domain containing 8
sheep(101115366) abhydrolase domain containing 8
domestic guinea pig(100732178) abhydrolase domain containing 8
naked mole-rat(101720449) abhydrolase domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024527 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160211 MISSION® esiRNA esiRNA human ABHD8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024527 Rosetta Predictions human pricing
NM_001107301 Rosetta Predictions rat pricing
NM_022419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148866 predicted 1228
2 SASI_Hs01_00148867 predicted 1258
3 SASI_Hs01_00148868 predicted 935
4 SASI_Hs01_00148869 predicted 1225
5 SASI_Hs01_00148870 predicted 954
6 SASI_Hs02_00356819 predicted 333
7 SASI_Hs01_00148871 predicted 1384
8 SASI_Hs01_00148872 predicted 1036
9 SASI_Hs01_00148873 predicted 1030
10 SASI_Hs01_00148874 predicted 954
11 SASI_Hs01_00148865 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227485 predicted 299
2 SASI_Rn02_00227486 predicted 1431
3 SASI_Rn02_00227487 predicted 1014
4 SASI_Rn02_00227488 predicted 438
5 SASI_Rn02_00227489 predicted 1528
6 SASI_Rn02_00227490 predicted 1153
7 SASI_Rn02_00227491 predicted 929
8 SASI_Rn02_00227492 predicted 1378
9 SASI_Rn02_00227493 predicted 620
10 SASI_Rn02_00227494 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129467 predicted 933
2 SASI_Mm01_00129468 predicted 863
3 SASI_Mm01_00129469 predicted 1364
4 SASI_Mm01_00129470 predicted 417
5 SASI_Mm01_00129471 predicted 1129
6 SASI_Mm01_00129472 predicted 598
7 SASI_Mm01_00129473 predicted 725
8 SASI_Mm01_00129475 predicted 837
9 SASI_Mm01_00129476 predicted 1419
10 SASI_Mm02_00326593 predicted 1254
11 SASI_Mm01_00129474 predicted 1662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022419
VALIDATED
ABHD8 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-1517s1c1
Sequence:CCGGCTTGAGTAGTAGAGGCTCTTACTCGAGTAAGAGCCTCTACTACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-907s1c1
Sequence:CCGGCGGTGTCTTCTTCTGTACTTTCTCGAGAAAGTACAGAAGAAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-1167s1c1
Sequence:CCGGCCATGATGAGTGGCCAGTATTCTCGAGAATACTGGCCACTCATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-895s1c1
Sequence:CCGGCGGCCATTCTTACGGTGTCTTCTCGAGAAGACACCGTAAGAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-1364s1c1
Sequence:CCGGGAAACGGTCAACACGCTGTTACTCGAGTAACAGCGTGTTGACCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022419.2-1516s21c1
Sequence:CCGGCTTGAGTAGTAGAGGCTCTTACTCGAGTAAGAGCCTCTACTACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022419.2-1363s21c1
Sequence:CCGGGAAACGGTCAACACGCTGTTACTCGAGTAACAGCGTGTTGACCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022419.2-1166s21c1
Sequence:CCGGCCATGATGAGTGGCCAGTATTCTCGAGAATACTGGCCACTCATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022419.2-906s21c1
Sequence:CCGGCGGTGTCTTCTTCTGTACTTTCTCGAGAAAGTACAGAAGAAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022419.2-894s21c1
Sequence:CCGGCGGCCATTCTTACGGTGTCTTCTCGAGAAGACACCGTAAGAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022419
VALIDATED
ABHD8 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-1517s1c1
Sequence:CCGGCTTGAGTAGTAGAGGCTCTTACTCGAGTAAGAGCCTCTACTACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-907s1c1
Sequence:CCGGCGGTGTCTTCTTCTGTACTTTCTCGAGAAAGTACAGAAGAAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-1167s1c1
Sequence:CCGGCCATGATGAGTGGCCAGTATTCTCGAGAATACTGGCCACTCATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-895s1c1
Sequence:CCGGCGGCCATTCTTACGGTGTCTTCTCGAGAAGACACCGTAAGAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-1364s1c1
Sequence:CCGGGAAACGGTCAACACGCTGTTACTCGAGTAACAGCGTGTTGACCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022419.2-1516s21c1
Sequence:CCGGCTTGAGTAGTAGAGGCTCTTACTCGAGTAAGAGCCTCTACTACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022419.2-1363s21c1
Sequence:CCGGGAAACGGTCAACACGCTGTTACTCGAGTAACAGCGTGTTGACCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022419.2-1166s21c1
Sequence:CCGGCCATGATGAGTGGCCAGTATTCTCGAGAATACTGGCCACTCATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022419.2-906s21c1
Sequence:CCGGCGGTGTCTTCTTCTGTACTTTCTCGAGAAAGTACAGAAGAAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022419.2-894s21c1
Sequence:CCGGCGGCCATTCTTACGGTGTCTTCTCGAGAAGACACCGTAAGAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022419
VALIDATED
ABHD8 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-1517s1c1
Sequence:CCGGCTTGAGTAGTAGAGGCTCTTACTCGAGTAAGAGCCTCTACTACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-907s1c1
Sequence:CCGGCGGTGTCTTCTTCTGTACTTTCTCGAGAAAGTACAGAAGAAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-1167s1c1
Sequence:CCGGCCATGATGAGTGGCCAGTATTCTCGAGAATACTGGCCACTCATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-895s1c1
Sequence:CCGGCGGCCATTCTTACGGTGTCTTCTCGAGAAGACACCGTAAGAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022419.1-1364s1c1
Sequence:CCGGGAAACGGTCAACACGCTGTTACTCGAGTAACAGCGTGTTGACCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022419.2-1516s21c1
Sequence:CCGGCTTGAGTAGTAGAGGCTCTTACTCGAGTAAGAGCCTCTACTACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022419.2-1363s21c1
Sequence:CCGGGAAACGGTCAACACGCTGTTACTCGAGTAACAGCGTGTTGACCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022419.2-1166s21c1
Sequence:CCGGCCATGATGAGTGGCCAGTATTCTCGAGAATACTGGCCACTCATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022419.2-906s21c1
Sequence:CCGGCGGTGTCTTCTTCTGTACTTTCTCGAGAAAGTACAGAAGAAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022419.2-894s21c1
Sequence:CCGGCGGCCATTCTTACGGTGTCTTCTCGAGAAGACACCGTAAGAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024527
ABHD8 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-895s1c1
Sequence:CCGGCGAGCAATCTTCAAGCGCTATCTCGAGATAGCGCTTGAAGATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-1175s1c1
Sequence:CCGGGCAACGCTTTCAACGTGTCATCTCGAGATGACACGTTGAAAGCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-1050s1c1
Sequence:CCGGCTTCTGCTCAATCTTCAACATCTCGAGATGTTGAAGATTGAGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-288s1c1
Sequence:CCGGCTACACCTTTGTAGAGGTCAACTCGAGTTGACCTCTACAAAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-910s1c1
Sequence:CCGGCGCTATGCCAAGAAGCGAAATCTCGAGATTTCGCTTCTTGGCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024527.4-731s21c1
Sequence:CCGGAGCGCATCACTAGCTGCAAAGCTCGAGCTTTGCAGCTAGTGATGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024527.4-702s21c1
Sequence:CCGGCAAGAGGACCATCCATATTGACTCGAGTCAATATGGATGGTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024527.4-1049s21c1
Sequence:CCGGACAAGGTGATCATGATCAATGCTCGAGCATTGATCATGATCACCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024527
ABHD8 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-895s1c1
Sequence:CCGGCGAGCAATCTTCAAGCGCTATCTCGAGATAGCGCTTGAAGATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-1175s1c1
Sequence:CCGGGCAACGCTTTCAACGTGTCATCTCGAGATGACACGTTGAAAGCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-1050s1c1
Sequence:CCGGCTTCTGCTCAATCTTCAACATCTCGAGATGTTGAAGATTGAGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-288s1c1
Sequence:CCGGCTACACCTTTGTAGAGGTCAACTCGAGTTGACCTCTACAAAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-910s1c1
Sequence:CCGGCGCTATGCCAAGAAGCGAAATCTCGAGATTTCGCTTCTTGGCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024527.4-731s21c1
Sequence:CCGGAGCGCATCACTAGCTGCAAAGCTCGAGCTTTGCAGCTAGTGATGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024527.4-702s21c1
Sequence:CCGGCAAGAGGACCATCCATATTGACTCGAGTCAATATGGATGGTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024527.4-1049s21c1
Sequence:CCGGACAAGGTGATCATGATCAATGCTCGAGCATTGATCATGATCACCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024527
ABHD8 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-895s1c1
Sequence:CCGGCGAGCAATCTTCAAGCGCTATCTCGAGATAGCGCTTGAAGATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-1175s1c1
Sequence:CCGGGCAACGCTTTCAACGTGTCATCTCGAGATGACACGTTGAAAGCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-1050s1c1
Sequence:CCGGCTTCTGCTCAATCTTCAACATCTCGAGATGTTGAAGATTGAGCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-288s1c1
Sequence:CCGGCTACACCTTTGTAGAGGTCAACTCGAGTTGACCTCTACAAAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024527.2-910s1c1
Sequence:CCGGCGCTATGCCAAGAAGCGAAATCTCGAGATTTCGCTTCTTGGCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024527.4-731s21c1
Sequence:CCGGAGCGCATCACTAGCTGCAAAGCTCGAGCTTTGCAGCTAGTGATGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024527.4-702s21c1
Sequence:CCGGCAAGAGGACCATCCATATTGACTCGAGTCAATATGGATGGTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024527.4-1049s21c1
Sequence:CCGGACAAGGTGATCATGATCAATGCTCGAGCATTGATCATGATCACCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks