EMAIL THIS PAGE TO A FRIEND

ABI1

abl-interactor 1

205 Gene Product Result for
Synonyms: ABI-1 ABLBP4 E3B1 NAP1BP SSH3BP SSH3BP1
Gene ID:
Human(10006) Summary: This gene encodes a member of the Abelson-interactor family of adaptor proteins. These proteins facilitate signal transduction as components of several multiprotein complexes, and regulate actin polymerization and cytoskeletal remodeling through interactions with Abelson tyrosine kinases. The encoded protein plays a role in macropinocytosis as a component of the WAVE2 complex, and also forms a complex with EPS8 and SOS1 that mediates signal transduction from Ras to Rac. This gene may play a role in the progression of several malignancies including melanoma, colon cancer and breast cancer, and a t(10;11) chromosomal translocation involving this gene and the MLL gene has been associated with acute myeloid leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Sep 2011]
Mouse(11308) abl-interactor 1
Rat(79249) abl-interactor 1
Thale Cress(828714) protein phosphatase 2C 56
dog(607247) abl-interactor 1
Horse(100055377) abl-interactor 1
cow(540815) abl-interactor 1
domestic cat(101082922) abl-interactor 1
chicken(420489) abl-interactor 1
naked mole-rat(101724965) abl-interactor 1
Domestic Rabbit(100349265) abl-interactor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005470 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059521 MISSION® esiRNA esiRNA human SSH3BP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012750 Rosetta Predictions human pricing
NM_001012751 Rosetta Predictions human pricing
NM_001012752 Rosetta Predictions human pricing
NM_005470 Rosetta Predictions human pricing
NM_024397 Rosetta Predictions rat pricing
XM_579491 Rosetta Predictions rat pricing
NM_001077190 Rosetta Predictions mouse pricing
NM_001077192 Rosetta Predictions mouse pricing
NM_001077193 Rosetta Predictions mouse pricing
NM_007380 Rosetta Predictions mouse pricing
NM_145994 Rosetta Predictions mouse pricing
XM_884090 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124418 predicted 1823
2 SASI_Hs01_00124417 predicted 366
3 SASI_Hs01_00124419 predicted 584
4 SASI_Hs01_00124420 predicted 784
5 SASI_Hs01_00124421 predicted 673
6 SASI_Hs01_00124422 predicted 558
7 SASI_Hs02_00306239 predicted 1647
8 SASI_Hs01_00124423 predicted 1126
9 SASI_Hs01_00124425 predicted 427
10 SASI_Hs01_00124426 predicted 447
11 SASI_Hs01_00124424 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179431 predicted 1733
2 SASI_Hs01_00179430 predicted 370
3 SASI_Hs01_00179432 predicted 580
4 SASI_Hs01_00179433 predicted 783
5 SASI_Hs01_00179434 predicted 677
6 SASI_Hs01_00179435 predicted 555
7 SASI_Hs02_00306240 predicted 1561
8 SASI_Hs01_00179436 predicted 1128
9 SASI_Hs01_00179438 predicted 427
10 SASI_Hs01_00179439 predicted 453
11 SASI_Hs01_00179437 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111402 predicted 371
2 SASI_Hs01_00111403 predicted 583
3 SASI_Hs01_00111404 predicted 768
4 SASI_Hs01_00111405 predicted 667
5 SASI_Hs01_00111406 predicted 561
6 SASI_Hs02_00306241 predicted 1631
7 SASI_Hs01_00111407 predicted 1114
8 SASI_Hs01_00111408 predicted 421
9 SASI_Hs01_00111409 predicted 432
10 SASI_Hs01_00111410 predicted 453
11 SASI_Hs01_00111411 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091165 predicted 365
2 SASI_Hs01_00091166 predicted 587
3 SASI_Hs01_00091167 predicted 777
4 SASI_Hs01_00091168 predicted 682
5 SASI_Hs01_00091169 predicted 555
6 SASI_Hs02_00339643 predicted 1724
7 SASI_Hs01_00091170 predicted 1207
8 SASI_Hs01_00091172 predicted 426
9 SASI_Hs01_00091173 predicted 448
10 SASI_Hs01_00091174 predicted 929
11 SASI_Hs01_00091171 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109294 predicted 1311
2 SASI_Rn01_00109295 predicted 462
3 SASI_Rn01_00109296 predicted 1393
4 SASI_Rn01_00109297 predicted 1335
5 SASI_Rn01_00109299 predicted 264
6 SASI_Rn01_00109300 predicted 1325
7 SASI_Rn01_00109301 predicted 404
8 SASI_Rn02_00263996 predicted 244
9 SASI_Rn01_00109302 predicted 824
10 SASI_Rn01_00109303 predicted 578
11 SASI_Rn01_00109298 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142311 predicted 694
2 SASI_Rn01_00142312 predicted 453
3 SASI_Rn01_00142313 predicted 458
4 SASI_Rn01_00142314 predicted 691
5 SASI_Rn01_00142315 predicted 751
6 SASI_Rn01_00142316 predicted 505
7 SASI_Rn01_00142317 predicted 530
8 SASI_Rn01_00142318 predicted 753
9 SASI_Rn01_00142319 predicted 582
10 SASI_Rn01_00142320 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292392 predicted 318
2 SASI_Mm02_00292393 predicted 315
3 SASI_Mm02_00292394 predicted 2095
4 SASI_Mm02_00292395 predicted 2092
5 SASI_Mm02_00292396 predicted 1832
6 SASI_Mm02_00292397 predicted 2111
7 SASI_Mm02_00292398 predicted 372
8 SASI_Mm02_00292399 predicted 1945
9 SASI_Mm02_00292400 predicted 1943
10 SASI_Mm02_00292401 predicted 1875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292402 predicted 318
2 SASI_Mm02_00292403 predicted 322
3 SASI_Mm02_00292404 predicted 1991
4 SASI_Mm02_00292405 predicted 1996
5 SASI_Mm02_00292406 predicted 1729
6 SASI_Mm02_00292407 predicted 2015
7 SASI_Mm02_00292408 predicted 375
8 SASI_Mm02_00292409 predicted 1840
9 SASI_Mm02_00292410 predicted 1837
10 SASI_Mm02_00292411 predicted 1772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292412 predicted 317
2 SASI_Mm02_00292413 predicted 316
3 SASI_Mm02_00292414 predicted 1810
4 SASI_Mm02_00292415 predicted 1815
5 SASI_Mm02_00292416 predicted 1558
6 SASI_Mm02_00292417 predicted 1833
7 SASI_Mm02_00292418 predicted 378
8 SASI_Mm02_00292419 predicted 1671
9 SASI_Mm02_00292420 predicted 1662
10 SASI_Mm02_00292421 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311476 predicted 310
2 SASI_Mm02_00311477 predicted 319
3 SASI_Mm02_00311478 predicted 2074
4 SASI_Mm02_00311479 predicted 2076
5 SASI_Mm01_00032653 predicted 1814
6 SASI_Mm02_00311480 predicted 2101
7 SASI_Mm02_00311481 predicted 373
8 SASI_Mm02_00311482 predicted 1934
9 SASI_Mm02_00311483 predicted 1922
10 SASI_Mm01_00032658 predicted 1858
11 SASI_Mm01_00032654 predicted 204
12 SASI_Mm01_00032655 predicted 259
13 SASI_Mm01_00032656 predicted 1474
14 SASI_Mm01_00032657 predicted 729
15 SASI_Mm01_00032659 predicted 657
16 SASI_Mm01_00032660 predicted 1534
17 SASI_Mm01_00032661 predicted 390
18 SASI_Mm01_00032662 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341511 predicted 313
2 SASI_Mm02_00341512 predicted 314
3 SASI_Mm02_00341513 predicted 2076
4 SASI_Mm02_00341514 predicted 2084
5 SASI_Mm02_00341515 predicted 1822
6 SASI_Mm02_00341516 predicted 2102
7 SASI_Mm02_00341517 predicted 371
8 SASI_Mm02_00341518 predicted 1932
9 SASI_Mm02_00341519 predicted 1926
10 SASI_Mm02_00341520 predicted 1858
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256084 predicted 435
2 SASI_Mm01_00256085 predicted 347
3 SASI_Mm01_00256086 predicted 374
4 SASI_Mm01_00256087 predicted 229
5 SASI_Mm01_00256088 predicted 365
6 SASI_Mm01_00256089 predicted 776
7 SASI_Mm01_00256090 predicted 581
8 SASI_Mm01_00256091 predicted 803
9 SASI_Mm01_00256092 predicted 314
10 SASI_Mm01_00256093 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005470
ABI1 MISSION shRNA Bacterial Glycerol Stock
abl-interactor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005470.2-2041s21c1
Sequence:CCGGCTAACGCTATGTCAGACTAATCTCGAGATTAGTCTGACATAGCGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005470.2-481s21c1
Sequence:CCGGCACGAAGAGAGATTGGTATTTCTCGAGAAATACCAATCTCTCTTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005470.2-575s21c1
Sequence:CCGGTATTCGGAAACCTATCGATTACTCGAGTAATCGATAGGTTTCCGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-1327s1c1
Sequence:CCGGCCACCACCAGTGGATTATGAACTCGAGTTCATAATCCACTGGTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-531s1c1
Sequence:CCGGCCATGGTGTCAAGTGGCTAAACTCGAGTTTAGCCACTTGACACCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-1189s1c1
Sequence:CCGGCCTCAGTTGACTCCACAGATACTCGAGTATCTGTGGAGTCAACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-843s1c1
Sequence:CCGGCAGTAGTATTGGCATTCCCATCTCGAGATGGGAATGCCAATACTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005470.1-235s1c1
Sequence:CCGGGCCTATACAACCCAATCTCTACTCGAGTAGAGATTGGGTTGTATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-700s1c1
Sequence:CCGGCCAACAGTTCCTAATGACTATCTCGAGATAGTCATTAGGAACTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005470
ABI1 MISSION shRNA shRNA Plasmid DNA
abl-interactor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005470.2-2041s21c1
Sequence:CCGGCTAACGCTATGTCAGACTAATCTCGAGATTAGTCTGACATAGCGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005470.2-481s21c1
Sequence:CCGGCACGAAGAGAGATTGGTATTTCTCGAGAAATACCAATCTCTCTTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005470.2-575s21c1
Sequence:CCGGTATTCGGAAACCTATCGATTACTCGAGTAATCGATAGGTTTCCGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-1327s1c1
Sequence:CCGGCCACCACCAGTGGATTATGAACTCGAGTTCATAATCCACTGGTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-531s1c1
Sequence:CCGGCCATGGTGTCAAGTGGCTAAACTCGAGTTTAGCCACTTGACACCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-1189s1c1
Sequence:CCGGCCTCAGTTGACTCCACAGATACTCGAGTATCTGTGGAGTCAACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-843s1c1
Sequence:CCGGCAGTAGTATTGGCATTCCCATCTCGAGATGGGAATGCCAATACTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005470.1-235s1c1
Sequence:CCGGGCCTATACAACCCAATCTCTACTCGAGTAGAGATTGGGTTGTATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-700s1c1
Sequence:CCGGCCAACAGTTCCTAATGACTATCTCGAGATAGTCATTAGGAACTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005470
ABI1 MISSION shRNA Lentiviral Transduction Particles
abl-interactor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005470.2-2041s21c1
Sequence:CCGGCTAACGCTATGTCAGACTAATCTCGAGATTAGTCTGACATAGCGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005470.2-481s21c1
Sequence:CCGGCACGAAGAGAGATTGGTATTTCTCGAGAAATACCAATCTCTCTTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005470.2-575s21c1
Sequence:CCGGTATTCGGAAACCTATCGATTACTCGAGTAATCGATAGGTTTCCGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-1327s1c1
Sequence:CCGGCCACCACCAGTGGATTATGAACTCGAGTTCATAATCCACTGGTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-531s1c1
Sequence:CCGGCCATGGTGTCAAGTGGCTAAACTCGAGTTTAGCCACTTGACACCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-1189s1c1
Sequence:CCGGCCTCAGTTGACTCCACAGATACTCGAGTATCTGTGGAGTCAACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-843s1c1
Sequence:CCGGCAGTAGTATTGGCATTCCCATCTCGAGATGGGAATGCCAATACTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005470.1-235s1c1
Sequence:CCGGGCCTATACAACCCAATCTCTACTCGAGTAGAGATTGGGTTGTATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005470.1-700s1c1
Sequence:CCGGCCAACAGTTCCTAATGACTATCTCGAGATAGTCATTAGGAACTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007380
VALIDATED
ABI1 MISSION shRNA Bacterial Glycerol Stock
abl-interactor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-488s21c1
Sequence:CCGGGCTCGAAGAGAGATTGGTATTCTCGAGAATACCAATCTCTCTTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-1056s21c1
Sequence:CCGGCGACATCTTCTGGTGGATATACTCGAGTATATCCACCAGAAGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-2082s21c1
Sequence:CCGGTCCAATTTGTGTAACGATTATCTCGAGATAATCGTTACACAAATTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-725s21c1
Sequence:CCGGCGAGGGACTTTGGGACGGAATCTCGAGATTCCGTCCCAAAGTCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-572s21c1
Sequence:CCGGCCTGTCAGGTATATTCGGAAACTCGAGTTTCCGAATATACCTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-352s1c1
Sequence:CCGGCGAGGGACTTTGGGACGGAATCTCGAGATTCCGTCCCAAAGTCCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-115s1c1
Sequence:CCGGGCTCGAAGAGAGATTGGTATTCTCGAGAATACCAATCTCTCTTCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-199s1c1
Sequence:CCGGCCTGTCAGGTATATTCGGAAACTCGAGTTTCCGAATATACCTGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-1212s1c1
Sequence:CCGGTGTTGAATCAATCATGCACTACTCGAGTAGTGCATGATTGATTCAACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-683s1c1
Sequence:CCGGCGACATCTTCTGGTGGATATACTCGAGTATATCCACCAGAAGATGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007380
VALIDATED
ABI1 MISSION shRNA shRNA Plasmid DNA
abl-interactor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-488s21c1
Sequence:CCGGGCTCGAAGAGAGATTGGTATTCTCGAGAATACCAATCTCTCTTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-1056s21c1
Sequence:CCGGCGACATCTTCTGGTGGATATACTCGAGTATATCCACCAGAAGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-2082s21c1
Sequence:CCGGTCCAATTTGTGTAACGATTATCTCGAGATAATCGTTACACAAATTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-725s21c1
Sequence:CCGGCGAGGGACTTTGGGACGGAATCTCGAGATTCCGTCCCAAAGTCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-572s21c1
Sequence:CCGGCCTGTCAGGTATATTCGGAAACTCGAGTTTCCGAATATACCTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-352s1c1
Sequence:CCGGCGAGGGACTTTGGGACGGAATCTCGAGATTCCGTCCCAAAGTCCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-115s1c1
Sequence:CCGGGCTCGAAGAGAGATTGGTATTCTCGAGAATACCAATCTCTCTTCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-199s1c1
Sequence:CCGGCCTGTCAGGTATATTCGGAAACTCGAGTTTCCGAATATACCTGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-1212s1c1
Sequence:CCGGTGTTGAATCAATCATGCACTACTCGAGTAGTGCATGATTGATTCAACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-683s1c1
Sequence:CCGGCGACATCTTCTGGTGGATATACTCGAGTATATCCACCAGAAGATGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007380
VALIDATED
ABI1 MISSION shRNA Lentiviral Transduction Particles
abl-interactor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-488s21c1
Sequence:CCGGGCTCGAAGAGAGATTGGTATTCTCGAGAATACCAATCTCTCTTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-1056s21c1
Sequence:CCGGCGACATCTTCTGGTGGATATACTCGAGTATATCCACCAGAAGATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-2082s21c1
Sequence:CCGGTCCAATTTGTGTAACGATTATCTCGAGATAATCGTTACACAAATTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-725s21c1
Sequence:CCGGCGAGGGACTTTGGGACGGAATCTCGAGATTCCGTCCCAAAGTCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007380.2-572s21c1
Sequence:CCGGCCTGTCAGGTATATTCGGAAACTCGAGTTTCCGAATATACCTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-352s1c1
Sequence:CCGGCGAGGGACTTTGGGACGGAATCTCGAGATTCCGTCCCAAAGTCCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-115s1c1
Sequence:CCGGGCTCGAAGAGAGATTGGTATTCTCGAGAATACCAATCTCTCTTCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-199s1c1
Sequence:CCGGCCTGTCAGGTATATTCGGAAACTCGAGTTTCCGAATATACCTGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-1212s1c1
Sequence:CCGGTGTTGAATCAATCATGCACTACTCGAGTAGTGCATGATTGATTCAACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007380.1-683s1c1
Sequence:CCGGCGACATCTTCTGGTGGATATACTCGAGTATATCCACCAGAAGATGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)