EMAIL THIS PAGE TO A FRIEND

ABI2

abl-interactor 2

145 Gene Product Result for
Synonyms: ABI-2 ABI2B AIP-1 AblBP3 SSH3BP2 argBPIA argBPIB
UniProtKB ID: Q9NYB9, B4DSN1, Q13147, Q13249, Q13801, Q9BV70
Gene ID:
Mouse(329165) abl-interactor 2
Rat(286928) abl-interactor 2
Thale Cress(835809) protein phosphatase 2C 77
dog(488485) abl-interactor 2
cow(537711) abl-interactor 2
domestic cat(101098245) abl-interactor 2
chicken(424108) abl-interactor 2
sheep(101113308) abl-interactor 2
Domestic Rabbit(100356964) abl-interactor 2
naked mole-rat(101723603) abl-interactor 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198127 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198127 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198127 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005759 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151731 MISSION® esiRNA esiRNA human ABI2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005759 Rosetta Predictions human pricing
NM_173143 Rosetta Predictions rat pricing
NM_198127 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153495 predicted 1488
2 SASI_Hs01_00153496 predicted 992
3 SASI_Hs02_00340230 predicted 654
4 SASI_Hs01_00153497 predicted 686
5 SASI_Hs02_00340231 predicted 1254
6 SASI_Hs02_00340232 predicted 547
7 SASI_Hs01_00153498 predicted 689
8 SASI_Hs01_00153499 predicted 848
9 SASI_Hs01_00153502 predicted 586
10 SASI_Hs01_00153503 predicted 912
11 SASI_Hs01_00153500 predicted 380
12 SASI_Hs01_00153501 predicted 1053
13 SASI_Hs01_00153504 predicted 1293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119076 predicted 300
2 SASI_Rn02_00269325 predicted 1644
3 SASI_Rn01_00119077 predicted 1249
4 SASI_Rn01_00119078 predicted 1282
5 SASI_Rn01_00119079 predicted 831
6 SASI_Rn01_00119080 predicted 1441
7 SASI_Rn01_00119081 predicted 1769
8 SASI_Rn01_00119083 predicted 1020
9 SASI_Rn01_00119084 predicted 310
10 SASI_Rn01_00119085 predicted 1339
11 SASI_Rn01_00119082 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350869 predicted 256
2 SASI_Mm01_00060787 predicted 1404
3 SASI_Mm01_00060788 predicted 1222
4 SASI_Mm01_00060789 predicted 314
5 SASI_Mm01_00060790 predicted 459
6 SASI_Mm01_00060792 predicted 233
7 SASI_Mm01_00060793 predicted 875
8 SASI_Mm01_00060794 predicted 1308
9 SASI_Mm01_00060795 predicted 1428
10 SASI_Mm01_00060796 predicted 1249
11 SASI_Mm01_00060791 predicted 1181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198127
VALIDATED
ABI2 MISSION shRNA Bacterial Glycerol Stock
abl-interactor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198127.1-3679s1c1
Sequence:CCGGGCCTACAGTAATCGGAGACTTCTCGAGAAGTCTCCGATTACTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198127.1-924s1c1
Sequence:CCGGCCTCCTTCCATAACGTCACAACTCGAGTTGTGACGTTATGGAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198127.1-264s1c1
Sequence:CCGGGAGTCTTCAATCAACCATATTCTCGAGAATATGGTTGATTGAAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198127.1-401s1c1
Sequence:CCGGGCCAGTTCGTTATATTCGAAACTCGAGTTTCGAATATAACGAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198127.1-938s1c1
Sequence:CCGGGTCACAAACAAGCCTTCAGAACTCGAGTTCTGAAGGCTTGTTTGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198127
VALIDATED
ABI2 MISSION shRNA shRNA Plasmid DNA
abl-interactor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198127.1-3679s1c1
Sequence:CCGGGCCTACAGTAATCGGAGACTTCTCGAGAAGTCTCCGATTACTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198127.1-924s1c1
Sequence:CCGGCCTCCTTCCATAACGTCACAACTCGAGTTGTGACGTTATGGAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198127.1-264s1c1
Sequence:CCGGGAGTCTTCAATCAACCATATTCTCGAGAATATGGTTGATTGAAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198127.1-401s1c1
Sequence:CCGGGCCAGTTCGTTATATTCGAAACTCGAGTTTCGAATATAACGAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198127.1-938s1c1
Sequence:CCGGGTCACAAACAAGCCTTCAGAACTCGAGTTCTGAAGGCTTGTTTGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198127
VALIDATED
ABI2 MISSION shRNA Lentiviral Transduction Particles
abl-interactor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198127.1-3679s1c1
Sequence:CCGGGCCTACAGTAATCGGAGACTTCTCGAGAAGTCTCCGATTACTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198127.1-924s1c1
Sequence:CCGGCCTCCTTCCATAACGTCACAACTCGAGTTGTGACGTTATGGAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198127.1-264s1c1
Sequence:CCGGGAGTCTTCAATCAACCATATTCTCGAGAATATGGTTGATTGAAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198127.1-401s1c1
Sequence:CCGGGCCAGTTCGTTATATTCGAAACTCGAGTTTCGAATATAACGAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198127.1-938s1c1
Sequence:CCGGGTCACAAACAAGCCTTCAGAACTCGAGTTCTGAAGGCTTGTTTGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005759
VALIDATED
ABI2 MISSION shRNA Bacterial Glycerol Stock
abl-interactor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005759.3-1606s1c1
Sequence:CCGGCCAGTAAAGTAGAATGAAGGACTCGAGTCCTTCATTCTACTTTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005759.3-1280s1c1
Sequence:CCGGGCTGTGGTTGAGTATAGTGATCTCGAGATCACTATACTCAACCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005759.3-1120s1c1
Sequence:CCGGCCTACAGGTAACTCCTACGTTCTCGAGAACGTAGGAGTTACCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005759.3-549s1c1
Sequence:CCGGGACATGGAGTAAAGGTGAGTACTCGAGTACTCACCTTTACTCCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005759.3-154s1c1
Sequence:CCGGCCTCTTCGACAGATACACAAACTCGAGTTTGTGTATCTGTCGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005759.4-1698s21c1
Sequence:CCGGGTCAGGTCTTCCCAGATTATCCTCGAGGATAATCTGGGAAGACCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005759.4-588s21c1
Sequence:CCGGCTTCAAGGACACATAAGATTACTCGAGTAATCTTATGTGTCCTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005759.4-859s21c1
Sequence:CCGGACCTAGCCCAACCCGTAATATCTCGAGATATTACGGGTTGGGCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005759.4-684s21c1
Sequence:CCGGGACATGGAGTAAAGGTGAGTACTCGAGTACTCACCTTTACTCCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005759.4-1415s21c1
Sequence:CCGGGCTGTGGTTGAGTATAGTGATCTCGAGATCACTATACTCAACCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005759
VALIDATED
ABI2 MISSION shRNA shRNA Plasmid DNA
abl-interactor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005759.3-1606s1c1
Sequence:CCGGCCAGTAAAGTAGAATGAAGGACTCGAGTCCTTCATTCTACTTTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005759.3-1280s1c1
Sequence:CCGGGCTGTGGTTGAGTATAGTGATCTCGAGATCACTATACTCAACCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005759.3-1120s1c1
Sequence:CCGGCCTACAGGTAACTCCTACGTTCTCGAGAACGTAGGAGTTACCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005759.3-549s1c1
Sequence:CCGGGACATGGAGTAAAGGTGAGTACTCGAGTACTCACCTTTACTCCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005759.3-154s1c1
Sequence:CCGGCCTCTTCGACAGATACACAAACTCGAGTTTGTGTATCTGTCGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005759.4-1698s21c1
Sequence:CCGGGTCAGGTCTTCCCAGATTATCCTCGAGGATAATCTGGGAAGACCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005759.4-588s21c1
Sequence:CCGGCTTCAAGGACACATAAGATTACTCGAGTAATCTTATGTGTCCTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005759.4-859s21c1
Sequence:CCGGACCTAGCCCAACCCGTAATATCTCGAGATATTACGGGTTGGGCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005759.4-684s21c1
Sequence:CCGGGACATGGAGTAAAGGTGAGTACTCGAGTACTCACCTTTACTCCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005759.4-1415s21c1
Sequence:CCGGGCTGTGGTTGAGTATAGTGATCTCGAGATCACTATACTCAACCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005759
VALIDATED
ABI2 MISSION shRNA Lentiviral Transduction Particles
abl-interactor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005759.3-1606s1c1
Sequence:CCGGCCAGTAAAGTAGAATGAAGGACTCGAGTCCTTCATTCTACTTTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005759.3-1280s1c1
Sequence:CCGGGCTGTGGTTGAGTATAGTGATCTCGAGATCACTATACTCAACCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005759.3-1120s1c1
Sequence:CCGGCCTACAGGTAACTCCTACGTTCTCGAGAACGTAGGAGTTACCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005759.3-549s1c1
Sequence:CCGGGACATGGAGTAAAGGTGAGTACTCGAGTACTCACCTTTACTCCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005759.3-154s1c1
Sequence:CCGGCCTCTTCGACAGATACACAAACTCGAGTTTGTGTATCTGTCGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005759.4-1698s21c1
Sequence:CCGGGTCAGGTCTTCCCAGATTATCCTCGAGGATAATCTGGGAAGACCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005759.4-588s21c1
Sequence:CCGGCTTCAAGGACACATAAGATTACTCGAGTAATCTTATGTGTCCTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005759.4-859s21c1
Sequence:CCGGACCTAGCCCAACCCGTAATATCTCGAGATATTACGGGTTGGGCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005759.4-684s21c1
Sequence:CCGGGACATGGAGTAAAGGTGAGTACTCGAGTACTCACCTTTACTCCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005759.4-1415s21c1
Sequence:CCGGGCTGTGGTTGAGTATAGTGATCTCGAGATCACTATACTCAACCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)