EMAIL THIS PAGE TO A FRIEND

ABI3

ABI family, member 3

48 Gene Product Result for
Synonyms: NESH SSH3BP3
UniProtKB ID: Q9P2A4, C9IZN8, Q9H0P6
Gene ID:
Human(51225) Summary: This gene encodes a member of an adaptor protein family. Members of this family encode proteins containing a homeobox homology domain, proline rich region and Src-homology 3 (SH3) domain, and are components of the Abi/WAVE complex which regulates Rac-dependent actin polymerization. The encoded protein inhibits ectopic metastasis of tumor cells as well as cell migration. This may be accomplished through interaction with p21-activated kinase. [provided by RefSeq, Sep 2008]
Mouse(66610) ABI gene family, member 3
Rat(303476) ABI family, member 3
Thale Cress(822061) B3 domain-containing transcription factor ABI3
domestic cat(101095931) ABI family, member 3
cow(529835) ABI family, member 3
dog(491068) ABI family, member 3
chicken(419988) ABI family, member 3
naked mole-rat(101707416) ABI family, member 3
domestic guinea pig(100717451) ABI family, member 3
sheep(101112745) ABI family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016428 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU067471 MISSION® esiRNA esiRNA targeting mouse Abi3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016428 Rosetta Predictions human pricing
NM_001013118 Rosetta Predictions rat pricing
NM_025659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155870 predicted 1626
2 SASI_Hs01_00155871 predicted 1450
3 SASI_Hs01_00155872 predicted 810
4 SASI_Hs01_00155873 predicted 1882
5 SASI_Hs01_00155874 predicted 1859
6 SASI_Hs01_00155875 predicted 1853
7 SASI_Hs01_00155877 predicted 1447
8 SASI_Hs01_00155878 predicted 960
9 SASI_Hs01_00155879 predicted 1855
10 SASI_Hs02_00349453 predicted 1434
11 SASI_Hs01_00155876 predicted 1803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098708 predicted 304
2 SASI_Rn01_00098709 predicted 1039
3 SASI_Rn01_00098710 predicted 605
4 SASI_Rn01_00098711 predicted 1000
5 SASI_Rn01_00098712 predicted 375
6 SASI_Rn01_00098713 predicted 428
7 SASI_Rn01_00098714 predicted 1031
8 SASI_Rn01_00098715 predicted 572
9 SASI_Rn01_00098716 predicted 1430
10 SASI_Rn01_00098717 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191862 predicted 765
2 SASI_Mm01_00191863 predicted 294
3 SASI_Mm01_00191864 predicted 213
4 SASI_Mm01_00191865 predicted 223
5 SASI_Mm01_00191866 predicted 1050
6 SASI_Mm01_00191867 predicted 236
7 SASI_Mm01_00191868 predicted 928
8 SASI_Mm01_00191869 predicted 933
9 SASI_Mm01_00191870 predicted 944
10 SASI_Mm02_00328794 predicted 344
11 SASI_Mm01_00191871 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025659
ABI3 MISSION shRNA Bacterial Glycerol Stock
ABI family, member 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025659.4-617s21c1
Sequence:CCGGTAGAAGGGAGATCGGCACTTTCTCGAGAAAGTGCCGATCTCCCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025659.4-730s21c1
Sequence:CCGGTTGCCTGCTTGGATGACATTGCTCGAGCAATGTCATCCAAGCAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025659.1-1192s1c1
Sequence:CCGGCCACAGTCAAAGCTGGACTAACTCGAGTTAGTCCAGCTTTGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025659.1-273s1c1
Sequence:CCGGGCGGCAGGTAGAAGCCAAGATCTCGAGATCTTGGCTTCTACCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025659.1-238s1c1
Sequence:CCGGACTCTTCGAATGCTGGATCTACTCGAGTAGATCCAGCATTCGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025659.1-964s1c1
Sequence:CCGGCTGTACCCATACACCCGGCAACTCGAGTTGCCGGGTGTATGGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025659.1-519s1c1
Sequence:CCGGCCTGTCTCGCAAGAGCATAAACTCGAGTTTATGCTCTTGCGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025659
ABI3 MISSION shRNA shRNA Plasmid DNA
ABI family, member 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025659.4-617s21c1
Sequence:CCGGTAGAAGGGAGATCGGCACTTTCTCGAGAAAGTGCCGATCTCCCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025659.4-730s21c1
Sequence:CCGGTTGCCTGCTTGGATGACATTGCTCGAGCAATGTCATCCAAGCAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025659.1-1192s1c1
Sequence:CCGGCCACAGTCAAAGCTGGACTAACTCGAGTTAGTCCAGCTTTGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025659.1-273s1c1
Sequence:CCGGGCGGCAGGTAGAAGCCAAGATCTCGAGATCTTGGCTTCTACCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025659.1-238s1c1
Sequence:CCGGACTCTTCGAATGCTGGATCTACTCGAGTAGATCCAGCATTCGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025659.1-964s1c1
Sequence:CCGGCTGTACCCATACACCCGGCAACTCGAGTTGCCGGGTGTATGGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025659.1-519s1c1
Sequence:CCGGCCTGTCTCGCAAGAGCATAAACTCGAGTTTATGCTCTTGCGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025659
ABI3 MISSION shRNA Lentiviral Transduction Particles
ABI family, member 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025659.4-617s21c1
Sequence:CCGGTAGAAGGGAGATCGGCACTTTCTCGAGAAAGTGCCGATCTCCCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025659.4-730s21c1
Sequence:CCGGTTGCCTGCTTGGATGACATTGCTCGAGCAATGTCATCCAAGCAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025659.1-1192s1c1
Sequence:CCGGCCACAGTCAAAGCTGGACTAACTCGAGTTAGTCCAGCTTTGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025659.1-273s1c1
Sequence:CCGGGCGGCAGGTAGAAGCCAAGATCTCGAGATCTTGGCTTCTACCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025659.1-238s1c1
Sequence:CCGGACTCTTCGAATGCTGGATCTACTCGAGTAGATCCAGCATTCGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025659.1-964s1c1
Sequence:CCGGCTGTACCCATACACCCGGCAACTCGAGTTGCCGGGTGTATGGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025659.1-519s1c1
Sequence:CCGGCCTGTCTCGCAAGAGCATAAACTCGAGTTTATGCTCTTGCGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016428
ABI3 MISSION shRNA Bacterial Glycerol Stock
ABI family, member 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016428.2-1562s21c1
Sequence:CCGGGATTCTTCCCTGGGAACTATGCTCGAGCATAGTTCCCAGGGAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016428.2-1952s21c1
Sequence:CCGGTCTAAGGCTGCTGCTAATTACCTCGAGGTAATTAGCAGCAGCCTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016428.2-995s21c1
Sequence:CCGGTGTCTCGAAAGAGCATCAAGGCTCGAGCCTTGATGCTCTTTCGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016428.2-967s21c1
Sequence:CCGGAGCACGCAGCTGTCAAGAACACTCGAGTGTTCTTGACAGCTGCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016428.2-789s1c1
Sequence:CCGGGAACATGCATATGGAGAAGGTCTCGAGACCTTCTCCATATGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016428.2-1799s1c1
Sequence:CCGGGAGCTGGAAACCAAGAAGTTTCTCGAGAAACTTCTTGGTTTCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016428.2-1864s1c1
Sequence:CCGGGCAAGTCCCAACTTTGAATAACTCGAGTTATTCAAAGTTGGGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016428.2-1801s1c1
Sequence:CCGGGCTGGAAACCAAGAAGTTTGTCTCGAGACAAACTTCTTGGTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016428.2-993s1c1
Sequence:CCGGCCTGTCTCGAAAGAGCATCAACTCGAGTTGATGCTCTTTCGAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016428.2-780s1c1
Sequence:CCGGCCAGATGGTGAACATGCATATCTCGAGATATGCATGTTCACCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016428.2-1464s1c1
Sequence:CCGGGAAGGACAATGAGCTCTCCTTCTCGAGAAGGAGAGCTCATTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016428
ABI3 MISSION shRNA shRNA Plasmid DNA
ABI family, member 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016428.2-1562s21c1
Sequence:CCGGGATTCTTCCCTGGGAACTATGCTCGAGCATAGTTCCCAGGGAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016428.2-1952s21c1
Sequence:CCGGTCTAAGGCTGCTGCTAATTACCTCGAGGTAATTAGCAGCAGCCTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016428.2-995s21c1
Sequence:CCGGTGTCTCGAAAGAGCATCAAGGCTCGAGCCTTGATGCTCTTTCGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016428.2-967s21c1
Sequence:CCGGAGCACGCAGCTGTCAAGAACACTCGAGTGTTCTTGACAGCTGCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016428.2-789s1c1
Sequence:CCGGGAACATGCATATGGAGAAGGTCTCGAGACCTTCTCCATATGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016428.2-1799s1c1
Sequence:CCGGGAGCTGGAAACCAAGAAGTTTCTCGAGAAACTTCTTGGTTTCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016428.2-1864s1c1
Sequence:CCGGGCAAGTCCCAACTTTGAATAACTCGAGTTATTCAAAGTTGGGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016428.2-1801s1c1
Sequence:CCGGGCTGGAAACCAAGAAGTTTGTCTCGAGACAAACTTCTTGGTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016428.2-993s1c1
Sequence:CCGGCCTGTCTCGAAAGAGCATCAACTCGAGTTGATGCTCTTTCGAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016428.2-780s1c1
Sequence:CCGGCCAGATGGTGAACATGCATATCTCGAGATATGCATGTTCACCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016428.2-1464s1c1
Sequence:CCGGGAAGGACAATGAGCTCTCCTTCTCGAGAAGGAGAGCTCATTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016428
ABI3 MISSION shRNA Lentiviral Transduction Particles
ABI family, member 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016428.2-1562s21c1
Sequence:CCGGGATTCTTCCCTGGGAACTATGCTCGAGCATAGTTCCCAGGGAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016428.2-1952s21c1
Sequence:CCGGTCTAAGGCTGCTGCTAATTACCTCGAGGTAATTAGCAGCAGCCTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016428.2-995s21c1
Sequence:CCGGTGTCTCGAAAGAGCATCAAGGCTCGAGCCTTGATGCTCTTTCGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016428.2-967s21c1
Sequence:CCGGAGCACGCAGCTGTCAAGAACACTCGAGTGTTCTTGACAGCTGCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016428.2-789s1c1
Sequence:CCGGGAACATGCATATGGAGAAGGTCTCGAGACCTTCTCCATATGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016428.2-1799s1c1
Sequence:CCGGGAGCTGGAAACCAAGAAGTTTCTCGAGAAACTTCTTGGTTTCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016428.2-1864s1c1
Sequence:CCGGGCAAGTCCCAACTTTGAATAACTCGAGTTATTCAAAGTTGGGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149111    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016428.2-1801s1c1
Sequence:CCGGGCTGGAAACCAAGAAGTTTGTCTCGAGACAAACTTCTTGGTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016428.2-993s1c1
Sequence:CCGGCCTGTCTCGAAAGAGCATCAACTCGAGTTGATGCTCTTTCGAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016428.2-780s1c1
Sequence:CCGGCCAGATGGTGAACATGCATATCTCGAGATATGCATGTTCACCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016428.2-1464s1c1
Sequence:CCGGGAAGGACAATGAGCTCTCCTTCTCGAGAAGGAGAGCTCATTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks