EMAIL THIS PAGE TO A FRIEND

ABI3BP

ABI family, member 3 (NESH) binding protein

Synonyms: NESHBP TARSH
UniProtKB ID: Q7Z7G0, B3KSL4, Q6ZW20, Q6ZW22, Q9C082, Q9UFI6
Gene ID:
Mouse(320712) ABI gene family, member 3 (NESH) binding protein
Rat(363767) ABI family, member 3 (NESH) binding protein
sheep(101108803) ABI family, member 3 (NESH) binding protein
domestic guinea pig(100723639) ABI family, member 3 (NESH) binding protein
naked mole-rat(101717706) ABI family, member 3 (NESH) binding protein
Zebrafish(100149890) ABI family, member 3 (NESH) binding protein
cow(538604) ABI family, member 3 (NESH) binding protein
Horse(100062052) ABI family, member 3 (NESH) binding protein
chicken(769237) ABI family, member 3 (NESH) binding protein
domestic cat(101099069) ABI family, member 3 (NESH) binding protein
dog(478544) ABI family, member 3 (NESH) binding protein
194 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015429 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140101 MISSION® esiRNA esiRNA human ABI3BP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015429 Rosetta Predictions human pricing
XM_001057627 Rosetta Predictions rat pricing
XM_344015 Rosetta Predictions rat pricing
NM_001014399 Rosetta Predictions mouse pricing
NM_001014422 Rosetta Predictions mouse pricing
NM_001014423 Rosetta Predictions mouse pricing
NM_001014424 Rosetta Predictions mouse pricing
NM_178790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112744 predicted 1966
2 SASI_Hs01_00112745 predicted 889
3 SASI_Hs01_00112746 predicted 975
4 SASI_Hs01_00112747 predicted 263
5 SASI_Hs02_00347814 predicted 1517
6 SASI_Hs01_00112749 predicted 904
7 SASI_Hs01_00112750 predicted 845
8 SASI_Hs01_00112751 predicted 3161
9 SASI_Hs01_00112752 predicted 2117
10 SASI_Hs01_00112753 predicted 2329
11 SASI_Hs01_00112748 predicted 2915
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286991 predicted 1322
2 SASI_Rn02_00286992 predicted 2202
3 SASI_Rn02_00286993 predicted 1886
4 SASI_Rn02_00286994 predicted 1040
5 SASI_Rn02_00286995 predicted 2407
6 SASI_Rn02_00286996 predicted 624
7 SASI_Rn02_00286997 predicted 1864
8 SASI_Rn02_00286998 predicted 754
9 SASI_Rn02_00286999 predicted 631
10 SASI_Rn02_00287000 predicted 2396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396674 predicted 1323
2 SASI_Rn02_00396675 predicted 2196
3 SASI_Rn02_00396676 predicted 1895
4 SASI_Rn02_00396677 predicted 1041
5 SASI_Rn02_00396678 predicted 2410
6 SASI_Rn02_00396679 predicted 616
7 SASI_Rn02_00396680 predicted 1862
8 SASI_Rn02_00396681 predicted 755
9 SASI_Rn02_00396682 predicted 635
10 SASI_Rn02_00396683 predicted 2398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287427 predicted 328
2 SASI_Mm01_00055222 predicted 2552
3 SASI_Mm01_00055223 predicted 2705
4 SASI_Mm01_00055224 predicted 2676
5 SASI_Mm01_00055225 predicted 603
6 SASI_Mm01_00055227 predicted 205
7 SASI_Mm01_00055228 predicted 573
8 SASI_Mm02_00287428 predicted 1920
9 SASI_Mm01_00055229 predicted 339
10 SASI_Mm01_00055230 predicted 532
11 SASI_Mm01_00055226 predicted 2232
12 SASI_Mm01_00055231 predicted 2215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287429 predicted 319
2 SASI_Mm01_00191032 predicted 3117
3 SASI_Mm01_00191033 predicted 3274
4 SASI_Mm01_00191034 predicted 3248
5 SASI_Mm01_00191035 predicted 611
6 SASI_Mm01_00191037 predicted 203
7 SASI_Mm01_00191038 predicted 569
8 SASI_Mm02_00287430 predicted 2493
9 SASI_Mm01_00191039 predicted 335
10 SASI_Mm01_00191040 predicted 540
11 SASI_Mm01_00191036 predicted 2803
12 SASI_Mm01_00191041 predicted 2784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287431 predicted 323
2 SASI_Mm01_00069922 predicted 3364
3 SASI_Mm01_00069923 predicted 3517
4 SASI_Mm01_00069924 predicted 3485
5 SASI_Mm01_00069925 predicted 612
6 SASI_Mm01_00069927 predicted 206
7 SASI_Mm01_00069928 predicted 568
8 SASI_Mm02_00287432 predicted 2729
9 SASI_Mm01_00069929 predicted 341
10 SASI_Mm01_00069930 predicted 533
11 SASI_Mm01_00069926 predicted 3043
12 SASI_Mm01_00069931 predicted 3028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287433 predicted 326
2 SASI_Mm01_00153784 predicted 3170
3 SASI_Mm01_00153785 predicted 3318
4 SASI_Mm01_00153786 predicted 3293
5 SASI_Mm01_00153787 predicted 606
6 SASI_Mm01_00153789 predicted 204
7 SASI_Mm01_00153790 predicted 573
8 SASI_Mm02_00287434 predicted 2535
9 SASI_Mm01_00153791 predicted 335
10 SASI_Mm01_00153792 predicted 534
11 SASI_Mm01_00153788 predicted 2857
12 SASI_Mm01_00153793 predicted 2840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349388 predicted 326
2 SASI_Mm01_00054806 predicted 3055
3 SASI_Mm01_00054807 predicted 3209
4 SASI_Mm01_00054808 predicted 3180
5 SASI_Mm01_00054809 predicted 606
6 SASI_Mm01_00054811 predicted 203
7 SASI_Mm01_00054812 predicted 573
8 SASI_Mm02_00349389 predicted 2427
9 SASI_Mm01_00054813 predicted 340
10 SASI_Mm01_00054814 predicted 539
11 SASI_Mm01_00054810 predicted 2742
12 SASI_Mm01_00054815 predicted 2731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015429
VALIDATED
ABI3BP MISSION shRNA Bacterial Glycerol Stock
ABI family, member 3 (NESH) binding protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-3446s1c1
Sequence:CCGGGCTGAGAGTATTTATCAGGTTCTCGAGAACCTGATAAATACTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-613s1c1
Sequence:CCGGCCACTGAAACAATTGTGGAAACTCGAGTTTCCACAATTGTTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-3299s1c1
Sequence:CCGGGCACAAAGTTACCTTCTGTTTCTCGAGAAACAGAAGGTAACTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-2337s1c1
Sequence:CCGGGAGAGAATAGAGACAGATATACTCGAGTATATCTGTCTCTATTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-4017s1c1
Sequence:CCGGGCTTTGTCAAACTATCCCTTTCTCGAGAAAGGGATAGTTTGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015429.3-1478s21c1
Sequence:CCGGTCTATCCCTTCTACACCTAAACTCGAGTTTAGGTGTAGAAGGGATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015429.3-1550s21c1
Sequence:CCGGGCCGGAACAATTACACCTAAACTCGAGTTTAGGTGTAATTGTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015429.3-363s21c1
Sequence:CCGGTTGATGCAGAGCCGAAATATCCTCGAGGATATTTCGGCTCTGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015429
VALIDATED
ABI3BP MISSION shRNA shRNA Plasmid DNA
ABI family, member 3 (NESH) binding protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-3446s1c1
Sequence:CCGGGCTGAGAGTATTTATCAGGTTCTCGAGAACCTGATAAATACTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-613s1c1
Sequence:CCGGCCACTGAAACAATTGTGGAAACTCGAGTTTCCACAATTGTTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-3299s1c1
Sequence:CCGGGCACAAAGTTACCTTCTGTTTCTCGAGAAACAGAAGGTAACTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-2337s1c1
Sequence:CCGGGAGAGAATAGAGACAGATATACTCGAGTATATCTGTCTCTATTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-4017s1c1
Sequence:CCGGGCTTTGTCAAACTATCCCTTTCTCGAGAAAGGGATAGTTTGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015429.3-1478s21c1
Sequence:CCGGTCTATCCCTTCTACACCTAAACTCGAGTTTAGGTGTAGAAGGGATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015429.3-1550s21c1
Sequence:CCGGGCCGGAACAATTACACCTAAACTCGAGTTTAGGTGTAATTGTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015429.3-363s21c1
Sequence:CCGGTTGATGCAGAGCCGAAATATCCTCGAGGATATTTCGGCTCTGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015429
VALIDATED
ABI3BP MISSION shRNA Lentiviral Transduction Particles
ABI family, member 3 (NESH) binding protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-3446s1c1
Sequence:CCGGGCTGAGAGTATTTATCAGGTTCTCGAGAACCTGATAAATACTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-613s1c1
Sequence:CCGGCCACTGAAACAATTGTGGAAACTCGAGTTTCCACAATTGTTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-3299s1c1
Sequence:CCGGGCACAAAGTTACCTTCTGTTTCTCGAGAAACAGAAGGTAACTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-2337s1c1
Sequence:CCGGGAGAGAATAGAGACAGATATACTCGAGTATATCTGTCTCTATTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015429.2-4017s1c1
Sequence:CCGGGCTTTGTCAAACTATCCCTTTCTCGAGAAAGGGATAGTTTGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015429.3-1478s21c1
Sequence:CCGGTCTATCCCTTCTACACCTAAACTCGAGTTTAGGTGTAGAAGGGATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015429.3-1550s21c1
Sequence:CCGGGCCGGAACAATTACACCTAAACTCGAGTTTAGGTGTAATTGTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015429.3-363s21c1
Sequence:CCGGTTGATGCAGAGCCGAAATATCCTCGAGGATATTTCGGCTCTGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178790
ABI3BP MISSION shRNA Bacterial Glycerol Stock
ABI family, member 3 (NESH) binding protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178790.2-1297s1c1
Sequence:CCGGGCCTTGATCTTGGTGACCAATCTCGAGATTGGTCACCAAGATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178790.2-87s1c1
Sequence:CCGGGCTCTGGGAAATGCACAGAAACTCGAGTTTCTGTGCATTTCCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178790.2-182s1c1
Sequence:CCGGGCGTCCAAATGCAAACGTAAACTCGAGTTTACGTTTGCATTTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178790.2-1172s1c1
Sequence:CCGGCGCAGGTTTAACACTGCTTTACTCGAGTAAAGCAGTGTTAAACCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178790.2-594s1c1
Sequence:CCGGCCCAACACAGTTTATGAATTTCTCGAGAAATTCATAAACTGTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178790.4-885s21c1
Sequence:CCGGCATCTGATTATTCCGGGTCTTCTCGAGAAGACCCGGAATAATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178790.4-160s21c1
Sequence:CCGGGCTTGAAAGTGCACATCAATACTCGAGTATTGATGTGCACTTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178790.4-336s21c1
Sequence:CCGGCCGAAGTATCTGATAGTCGTACTCGAGTACGACTATCAGATACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178790
ABI3BP MISSION shRNA shRNA Plasmid DNA
ABI family, member 3 (NESH) binding protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178790.2-1297s1c1
Sequence:CCGGGCCTTGATCTTGGTGACCAATCTCGAGATTGGTCACCAAGATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178790.2-87s1c1
Sequence:CCGGGCTCTGGGAAATGCACAGAAACTCGAGTTTCTGTGCATTTCCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178790.2-182s1c1
Sequence:CCGGGCGTCCAAATGCAAACGTAAACTCGAGTTTACGTTTGCATTTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178790.2-1172s1c1
Sequence:CCGGCGCAGGTTTAACACTGCTTTACTCGAGTAAAGCAGTGTTAAACCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178790.2-594s1c1
Sequence:CCGGCCCAACACAGTTTATGAATTTCTCGAGAAATTCATAAACTGTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178790.4-885s21c1
Sequence:CCGGCATCTGATTATTCCGGGTCTTCTCGAGAAGACCCGGAATAATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178790.4-160s21c1
Sequence:CCGGGCTTGAAAGTGCACATCAATACTCGAGTATTGATGTGCACTTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178790.4-336s21c1
Sequence:CCGGCCGAAGTATCTGATAGTCGTACTCGAGTACGACTATCAGATACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178790
ABI3BP MISSION shRNA Lentiviral Transduction Particles
ABI family, member 3 (NESH) binding protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178790.2-1297s1c1
Sequence:CCGGGCCTTGATCTTGGTGACCAATCTCGAGATTGGTCACCAAGATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178790.2-87s1c1
Sequence:CCGGGCTCTGGGAAATGCACAGAAACTCGAGTTTCTGTGCATTTCCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178790.2-182s1c1
Sequence:CCGGGCGTCCAAATGCAAACGTAAACTCGAGTTTACGTTTGCATTTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178790.2-1172s1c1
Sequence:CCGGCGCAGGTTTAACACTGCTTTACTCGAGTAAAGCAGTGTTAAACCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178790.2-594s1c1
Sequence:CCGGCCCAACACAGTTTATGAATTTCTCGAGAAATTCATAAACTGTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178790.4-885s21c1
Sequence:CCGGCATCTGATTATTCCGGGTCTTCTCGAGAAGACCCGGAATAATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178790.4-160s21c1
Sequence:CCGGGCTTGAAAGTGCACATCAATACTCGAGTATTGATGTGCACTTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178790.4-336s21c1
Sequence:CCGGCCGAAGTATCTGATAGTCGTACTCGAGTACGACTATCAGATACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks