EMAIL THIS PAGE TO A FRIEND

ABL1

c-abl oncogene 1, non-receptor tyrosine kinase

174 Gene Product Result for
Synonyms: ABL JTK7 bcr/abl c-ABL p150 v-abl
Gene ID:
Human(25) Summary: The ABL1 protooncogene encodes a cytoplasmic and nuclear protein tyrosine kinase that has been implicated in processes of cell differentiation, cell division, cell adhesion, and stress response. Activity of c-Abl protein is negatively regulated by its SH3 domain, and deletion of the SH3 domain turns ABL1 into an oncogene. The t(9;22) translocation results in the head-to-tail fusion of the BCR (MIM:151410) and ABL1 genes present in many cases of chronic myelogeneous leukemia. The DNA-binding activity of the ubiquitously expressed ABL1 tyrosine kinase is regulated by CDC2-mediated phosphorylation, suggesting a cell cycle function for ABL1. The ABL1 gene is expressed as either a 6- or 7-kb mRNA transcript, with alternatively spliced first exons spliced to the common exons 2-11. [provided by RefSeq, Jul 2008]
Mouse(11350) c-abl oncogene 1, non-receptor tyrosine kinase
Rat(311860) c-abl oncogene 1, non-receptor tyrosine kinase
Zebrafish(100000720) c-abl oncogene 1, receptor tyrosine kinase
domestic cat(101087622) c-abl oncogene 1, non-receptor tyrosine kinase
cow(540876) c-abl oncogene 1, non-receptor tyrosine kinase
Horse(100069715) c-abl oncogene 1, non-receptor tyrosine kinase
dog(491292) c-abl oncogene 1, non-receptor tyrosine kinase
chicken(417181) c-abl oncogene 1, non-receptor tyrosine kinase
naked mole-rat(101724428) c-abl oncogene 1, non-receptor tyrosine kinase
domestic guinea pig(100720976) c-abl oncogene 1, non-receptor tyrosine kinase
sheep(101122941) c-abl oncogene 1, non-receptor tyrosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501043 Anti-ABL antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing
SAB4501044 Anti-ABL, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
HPA027251 Anti-ABL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunohistochemistry pricing
HPA027280 Anti-ABL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunofluorescence, immunohistochemistry pricing
HPA028409 Anti-ABL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4501046 Anti-ABL1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4501047 Anti-ABL1, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1305659 ANTI-C ABL (ABL1)(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4501045 Anti-C-ABL antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB4500045 Anti-C-ABL, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4503850 Anti-phospho-Abl (pTyr204) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4301401 Anti-phospho-Abl (pTyr204) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4504330 Anti-phospho-Abl (pTyr393/412) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503849 Anti-phospho-Abl (pTyr412) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1305623 ANTI-PHOSPHO-ABL(Y204) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence pricing
SAB1306088 ANTI-PHOSPHO-ABL(Y412) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4504602 Anti-phospho-ABL1 (pThr735) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301287 Anti-phospho-ABL1 (pThr735) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300273 Anti-phospho-ABL1/ABL2 (pTyr393/429) antibody produced in rabbit affinity isolated antibody mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
C5365 Anti-phospho-c-Abl (pTyr245) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
western blot pricing
SAB4504022 Anti-phospho-c-Abl (pTyr245) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB4301486 Anti-phospho-c-Abl (pTyr245) antibody produced in rabbit affinity isolated antibody human
western blot pricing
C5240 Anti-phospho-c-Abl (pTyr412) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB5300355 Monoclonal Anti-ABL1 antibody produced in mouse clone 7B11D6, ascites fluid human
ELISA, western blot pricing
A5844 Monoclonal Anti-c-Abl antibody produced in mouse clone ABL-148, ascites fluid monkey, mouse, human, rat, bovine
flow cytometry, immunocytochemistry, immunoprecipitation, microarray, western blot pricing
PLA0203 Rabbit anti-cAbl Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, gibbon, primate, marmoset
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing
PLA0204 Rabbit anti-cAbl Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rhesus monkey, marmoset, human, gorilla, chimpanzee, primate, gibbon
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005157 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005157 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005157 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007313 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
14-750-M Abl (H396P) Protein, active, 10 µg 10 µg, Active, N-terminal 6His-tagged recombinant human Abl, residues 27-end containing the H396P mutation. Expressed by baculovirus in Sf21 insect cells. For use in Kinase Assays. pricing
14-757 Abl (M351T) Protein, active, 10 µg 10 µg, Active, N-terminal 6His-tagged recombinant human Abl, residues 27-end containing the M351T mutation. For use in Kinase Assays. pricing
14-529-M Abl Protein, active, 10 µg 10 µg, Active, N-terminal His6-tagged recombinant human Abl, residues 27-end, for use in Kinase Assays. pricing
14-459-M Abl Protein, active, mouse, 10 µg 10 µg, Active, recombinant mouse Abl, residues 27-1123, containing N-terminal His-6 tag, for use in Kinase Assays. pricing
14-751-M Abl (Q252H) Protein, active, 10 µg 10 µg, Active, N-terminal 6His-tagged recombinant human Abl, residues 27-end containing the Q252H mutation. For use in Kinase Assays. pricing
14-522-M Abl (T315I) Protein, active, 10 µg 10 µg, Active, N-terminal His6-tagged recombinant human Abl, residues 27-end containing the T315I mutation. For use in Kinase Assays. pricing
14-759 Abl (Y253F) Protein, active, 10 µg 10 µg, Active, N-terminal 6His-tagged recombinant human Abl, residues 27-end containing the Y253F mutation. For use in Kinase Assays. pricing
12-493 Abltide 1 mg pricing
12-539 Abltide, biotin conjugate 500 µg, Abltide, biotin conjugate primarily used in Kinase Assays. pricing
MABT203 Anti-Abl (c-, v-, Bcr-) Antibody, clone 24-21 100 µg, Anti-Abl (c-, v-, Bcr-) Antibody, clone 24-21 detects level of Abl (c-, v-, Bcr-), clone 24-21 & has been published & validated for use in Western Blotting, ICC. pricing
06-466 Anti-Abl SH3 Domain Antibody 250 µg, Anti-Abl SH3 Domain Antibody detects level of Abl SH3 Domain & has been published & validated for use in IP & WB. pricing
MAB1130 Anti-c-abl Antibody, clone 8E9 100 µg, This Anti-c-abl Antibody, clone 8E9 is validated for use in IF, IH(P), IP, WB for the detection of c-abl.This antibody has been tested in Human and Mouse. pricing
AB3898 Anti-c-abl Tyrosine Kinase Antibody, cytoplasmic & nuclear 100 µg, Detect c-abl Tyrosine Kinase using this Anti-c-abl Tyrosine Kinase Antibody, cytoplasmic & nuclear validated for use in WB. pricing
07-787 Anti-phospho-Abl (Tyr245) Antibody 100 µL, Anti-phospho-Abl (Tyr245) Antibody is an antibody against phospho-Abl (Tyr245) for use in ELISA & WB. pricing
07-788 Anti-phospho-Abl (Tyr412) Antibody 100 µL, This Anti-phospho-Abl (Tyr412) Antibody is validated for use in ELISA, WB for the detection of phospho-Abl (Tyr412). pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005157 Rosetta Predictions human pricing
NM_007313 Rosetta Predictions human pricing
XM_001067860 Rosetta Predictions rat pricing
XM_001079831 Rosetta Predictions rat pricing
XM_231137 Rosetta Predictions rat pricing
NM_001112703 Rosetta Predictions mouse pricing
NM_009594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174552 predicted 716
2 SASI_Hs01_00174553 predicted 1708
3 SASI_Hs01_00174554 predicted 653
4 SASI_Hs01_00174555 predicted 587
5 SASI_Hs02_00339097 predicted 354
6 SASI_Hs01_00174556 predicted 2811
7 SASI_Hs01_00174557 predicted 1497
8 SASI_Hs01_00174558 predicted 1473
9 SASI_Hs01_00174559 predicted 432
10 SASI_Hs01_00174560 predicted 1754
11 SASI_Hs01_00174561 predicted 2237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154491 predicted 1214
2 SASI_Hs01_00154492 predicted 2193
3 SASI_Hs01_00154493 predicted 1149
4 SASI_Hs01_00154494 predicted 1077
5 SASI_Hs02_00343383 predicted 848
6 SASI_Hs01_00154495 predicted 3301
7 SASI_Hs01_00154496 predicted 1995
8 SASI_Hs01_00154497 predicted 1971
9 SASI_Hs01_00154498 predicted 918
10 SASI_Hs01_00154499 predicted 2239
11 SASI_Hs01_00154500 predicted 2735
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322591 predicted 2995
2 SASI_Rn02_00322592 predicted 3539
3 SASI_Rn02_00322593 predicted 2617
4 SASI_Rn02_00322594 predicted 2540
5 SASI_Rn02_00322595 predicted 3556
6 SASI_Rn02_00322596 predicted 1809
7 SASI_Rn02_00322597 predicted 4648
8 SASI_Rn02_00322598 predicted 1292
9 SASI_Rn02_00322599 predicted 2747
10 SASI_Rn02_00322600 predicted 2635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079831 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365638 predicted 1722
2 SASI_Rn02_00365639 predicted 2266
3 SASI_Rn02_00365640 predicted 1338
4 SASI_Rn02_00365641 predicted 1268
5 SASI_Rn02_00365642 predicted 2284
6 SASI_Rn02_00365643 predicted 3376
7 SASI_Rn02_00365644 predicted 2272
8 SASI_Rn02_00365645 predicted 627
9 SASI_Rn02_00365646 predicted 1473
10 SASI_Rn02_00365647 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386684 predicted 1742
2 SASI_Rn02_00386685 predicted 2289
3 SASI_Rn02_00386686 predicted 1361
4 SASI_Rn02_00386687 predicted 1287
5 SASI_Rn02_00386688 predicted 2301
6 SASI_Rn02_00386689 predicted 553
7 SASI_Rn02_00386690 predicted 284
8 SASI_Rn02_00386691 predicted 3398
9 SASI_Rn02_00386692 predicted 1499
10 SASI_Rn02_00386693 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306953 predicted 3539
2 SASI_Mm02_00306954 predicted 2614
3 SASI_Mm02_00306955 predicted 2781
4 SASI_Mm02_00306956 predicted 1680
5 SASI_Mm02_00306957 predicted 3546
6 SASI_Mm02_00306958 predicted 1796
7 SASI_Mm02_00306959 predicted 4643
8 SASI_Mm02_00306960 predicted 1878
9 SASI_Mm02_00306961 predicted 1885
10 SASI_Mm02_00306962 predicted 1962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046087 predicted 2323
2 SASI_Mm01_00046088 predicted 1394
3 SASI_Mm01_00046089 predicted 1560
4 SASI_Mm01_00046090 predicted 466
5 SASI_Mm01_00046091 predicted 2332
6 SASI_Mm01_00046092 predicted 582
7 SASI_Mm01_00046093 predicted 3427
8 SASI_Mm01_00046094 predicted 656
9 SASI_Mm01_00046095 predicted 670
10 SASI_Mm01_00046096 predicted 744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009594
VALIDATED
ABL1 MISSION shRNA Bacterial Glycerol Stock
c-abl oncogene 1, non-receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009594.3-3947s21c1
Sequence:CCGGGGAAGGAAGCTGTCGCTTTAACTCGAGTTAAAGCGACAGCTTCCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009594.3-863s21c1
Sequence:CCGGCGAGGGCGTTTGGAAGAAGTACTCGAGTACTTCTTCCAAACGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009594.3-3504s21c1
Sequence:CCGGCAGGGCTCTTGTGCCTATAAACTCGAGTTTATAGGCACAAGAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009594.3-354s21c1
Sequence:CCGGCTCCGGGTCTTGGGTTATAATCTCGAGATTATAACCCAAGACCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009594.3-1355s21c1
Sequence:CCGGCGTGTGGGCATTTGGAGTATTCTCGAGAATACTCCAAATGCCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009594.1-1319s1c1
Sequence:CCGGCGTGTGGGCATTTGGAGTATTCTCGAGAATACTCCAAATGCCCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009594.1-827s1c1
Sequence:CCGGCGAGGGCGTTTGGAAGAAGTACTCGAGTACTTCTTCCAAACGCCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009594.1-3224s1c1
Sequence:CCGGGTACACTTTCTGTGTGAGCTACTCGAGTAGCTCACACAGAAAGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009594
VALIDATED
ABL1 MISSION shRNA shRNA Plasmid DNA
c-abl oncogene 1, non-receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009594.3-3947s21c1
Sequence:CCGGGGAAGGAAGCTGTCGCTTTAACTCGAGTTAAAGCGACAGCTTCCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009594.3-863s21c1
Sequence:CCGGCGAGGGCGTTTGGAAGAAGTACTCGAGTACTTCTTCCAAACGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009594.3-3504s21c1
Sequence:CCGGCAGGGCTCTTGTGCCTATAAACTCGAGTTTATAGGCACAAGAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009594.3-354s21c1
Sequence:CCGGCTCCGGGTCTTGGGTTATAATCTCGAGATTATAACCCAAGACCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009594.3-1355s21c1
Sequence:CCGGCGTGTGGGCATTTGGAGTATTCTCGAGAATACTCCAAATGCCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009594.1-1319s1c1
Sequence:CCGGCGTGTGGGCATTTGGAGTATTCTCGAGAATACTCCAAATGCCCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009594.1-827s1c1
Sequence:CCGGCGAGGGCGTTTGGAAGAAGTACTCGAGTACTTCTTCCAAACGCCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009594.1-3224s1c1
Sequence:CCGGGTACACTTTCTGTGTGAGCTACTCGAGTAGCTCACACAGAAAGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009594
VALIDATED
ABL1 MISSION shRNA Lentiviral Transduction Particles
c-abl oncogene 1, non-receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009594.3-3947s21c1
Sequence:CCGGGGAAGGAAGCTGTCGCTTTAACTCGAGTTAAAGCGACAGCTTCCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009594.3-863s21c1
Sequence:CCGGCGAGGGCGTTTGGAAGAAGTACTCGAGTACTTCTTCCAAACGCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009594.3-3504s21c1
Sequence:CCGGCAGGGCTCTTGTGCCTATAAACTCGAGTTTATAGGCACAAGAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009594.3-354s21c1
Sequence:CCGGCTCCGGGTCTTGGGTTATAATCTCGAGATTATAACCCAAGACCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009594.3-1355s21c1
Sequence:CCGGCGTGTGGGCATTTGGAGTATTCTCGAGAATACTCCAAATGCCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009594.1-1319s1c1
Sequence:CCGGCGTGTGGGCATTTGGAGTATTCTCGAGAATACTCCAAATGCCCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009594.1-827s1c1
Sequence:CCGGCGAGGGCGTTTGGAAGAAGTACTCGAGTACTTCTTCCAAACGCCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009594.1-3224s1c1
Sequence:CCGGGTACACTTTCTGTGTGAGCTACTCGAGTAGCTCACACAGAAAGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005157
VALIDATED
ABL1 MISSION shRNA Bacterial Glycerol Stock
c-abl oncogene 1, non-receptor tyrosine kinase
Human
29 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005157.3-1462s21c1
Sequence:CCGGGCTGAAATCCACCAAGCCTTTCTCGAGAAAGGCTTGGTGGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005157.3-865s21c1
Sequence:CCGGGCAGTCATGAAAGAGATCAAACTCGAGTTTGATCTCTTTCATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005157.3-3354s21c1
Sequence:CCGGCCTCAGTTCGGTGAAGGAAATCTCGAGATTTCCTTCACCGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005157.3-1127s21c1
Sequence:CCGGACTTGGTGAAGGTAGCTGATTCTCGAGAATCAGCTACCTTCACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005157.3-4458s21c1
Sequence:CCGGGAGTTCTTGAAGCATTTCAAACTCGAGTTTGAAATGCTTCAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-951s1c1
Sequence:CCGGCCGAGTTGGTTCATCATCATTCTCGAGAATGATGATGAACCAACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-1291s1c1
Sequence:CCGGCCCGTTCTATATCATCACTGACTCGAGTCAGTGATGATATAGAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-3369s1c1
Sequence:CCGGCCTTCATCCCTCTCATATCAACTCGAGTTGATATGAGAGGGATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-1234s1c1
Sequence:CCGGGAAAGAGATCAAACACCCTAACTCGAGTTAGGGTGTTTGATCTCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-3910s1c1
Sequence:CCGGCCAGCTCTACTACCTACGTTTCTCGAGAAACGTAGGTAGTAGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-4458s1c1
Sequence:CCGGGAGTTCTTGAAGCATTTCAAACTCGAGTTTGAAATGCTTCAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-3354s1c1
Sequence:CCGGCCTCAGTTCGGTGAAGGAAATCTCGAGATTTCCTTCACCGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-1287s1c1
Sequence:CCGGGCTTTGGGAAATTGCTACCTACTCGAGTAGGTAGCAATTTCCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005157.3-3274s1c1
Sequence:CCGGGAGAATAATCTCCGGGAGCTTCTCGAGAAGCTCCCGGAGATTATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005157.3-693s1c1
Sequence:CCGGCAACTACGACAAGTGGGAGATCTCGAGATCTCCCACTTGTCGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-224s1c1
Sequence:CCGGCCAGTGGAGATAACACTCTAACTCGAGTTAGAGTGTTATCTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-3002s1c1
Sequence:CCGGCCGCCTTCATCCCTCTCATATCTCGAGATATGAGAGGGATGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005157.3-267s1c1
Sequence:CCGGCCGGGTCTTAGGCTATAATCACTCGAGTGATTATAGCCTAAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-3204s1c1
Sequence:CCGGCGTGAGCTATGTGGATTCCATCTCGAGATGGAATCCACATAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005157.3-4388s1c1
Sequence:CCGGCCACTCCTCTAAGACAAAGTACTCGAGTACTTTGTCTTAGAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-2238s1c1
Sequence:CCGGACAGTTTGACTCGTCCACATTCTCGAGAATGTGGACGAGTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-1127s1c1
Sequence:CCGGACTTGGTGAAGGTAGCTGATTCTCGAGAATCAGCTACCTTCACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-93s1c1
Sequence:CCGGGCGGCCAGTAGCATCTGACTTCTCGAGAAGTCAGATGCTACTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-950s1c1
Sequence:CCGGGCCGAGTTGGTTCATCATCATCTCGAGATGATGATGAACCAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-716s1c1
Sequence:CCGGCCAGTCAACAGTCTGGAGAAACTCGAGTTTCTCCAGACTGTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-3620s1c1
Sequence:CCGGGCCATCAACAAACTGGAGAATCTCGAGATTCTCCAGTTTGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-1823s1c1
Sequence:CCGGGCTGAAATCCACCAAGCCTTTCTCGAGAAAGGCTTGGTGGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-1226s1c1
Sequence:CCGGGCAGTCATGAAAGAGATCAAACTCGAGTTTGATCTCTTTCATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005157.3-2381s1c1
Sequence:CCGGCTGCTGATGAGGTCTTCAAAGCTCGAGCTTTGAAGACCTCATCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005157
VALIDATED
ABL1 MISSION shRNA shRNA Plasmid DNA
c-abl oncogene 1, non-receptor tyrosine kinase
Human
29 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005157.3-1462s21c1
Sequence:CCGGGCTGAAATCCACCAAGCCTTTCTCGAGAAAGGCTTGGTGGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005157.3-865s21c1
Sequence:CCGGGCAGTCATGAAAGAGATCAAACTCGAGTTTGATCTCTTTCATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005157.3-3354s21c1
Sequence:CCGGCCTCAGTTCGGTGAAGGAAATCTCGAGATTTCCTTCACCGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005157.3-1127s21c1
Sequence:CCGGACTTGGTGAAGGTAGCTGATTCTCGAGAATCAGCTACCTTCACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005157.3-4458s21c1
Sequence:CCGGGAGTTCTTGAAGCATTTCAAACTCGAGTTTGAAATGCTTCAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-951s1c1
Sequence:CCGGCCGAGTTGGTTCATCATCATTCTCGAGAATGATGATGAACCAACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-1291s1c1
Sequence:CCGGCCCGTTCTATATCATCACTGACTCGAGTCAGTGATGATATAGAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-3369s1c1
Sequence:CCGGCCTTCATCCCTCTCATATCAACTCGAGTTGATATGAGAGGGATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-1234s1c1
Sequence:CCGGGAAAGAGATCAAACACCCTAACTCGAGTTAGGGTGTTTGATCTCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-3910s1c1
Sequence:CCGGCCAGCTCTACTACCTACGTTTCTCGAGAAACGTAGGTAGTAGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-4458s1c1
Sequence:CCGGGAGTTCTTGAAGCATTTCAAACTCGAGTTTGAAATGCTTCAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-3354s1c1
Sequence:CCGGCCTCAGTTCGGTGAAGGAAATCTCGAGATTTCCTTCACCGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-1287s1c1
Sequence:CCGGGCTTTGGGAAATTGCTACCTACTCGAGTAGGTAGCAATTTCCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005157.3-3274s1c1
Sequence:CCGGGAGAATAATCTCCGGGAGCTTCTCGAGAAGCTCCCGGAGATTATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005157.3-693s1c1
Sequence:CCGGCAACTACGACAAGTGGGAGATCTCGAGATCTCCCACTTGTCGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-224s1c1
Sequence:CCGGCCAGTGGAGATAACACTCTAACTCGAGTTAGAGTGTTATCTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-3002s1c1
Sequence:CCGGCCGCCTTCATCCCTCTCATATCTCGAGATATGAGAGGGATGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005157.3-267s1c1
Sequence:CCGGCCGGGTCTTAGGCTATAATCACTCGAGTGATTATAGCCTAAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-3204s1c1
Sequence:CCGGCGTGAGCTATGTGGATTCCATCTCGAGATGGAATCCACATAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005157.3-4388s1c1
Sequence:CCGGCCACTCCTCTAAGACAAAGTACTCGAGTACTTTGTCTTAGAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-2238s1c1
Sequence:CCGGACAGTTTGACTCGTCCACATTCTCGAGAATGTGGACGAGTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-1127s1c1
Sequence:CCGGACTTGGTGAAGGTAGCTGATTCTCGAGAATCAGCTACCTTCACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-93s1c1
Sequence:CCGGGCGGCCAGTAGCATCTGACTTCTCGAGAAGTCAGATGCTACTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-950s1c1
Sequence:CCGGGCCGAGTTGGTTCATCATCATCTCGAGATGATGATGAACCAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-716s1c1
Sequence:CCGGCCAGTCAACAGTCTGGAGAAACTCGAGTTTCTCCAGACTGTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-3620s1c1
Sequence:CCGGGCCATCAACAAACTGGAGAATCTCGAGATTCTCCAGTTTGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-1823s1c1
Sequence:CCGGGCTGAAATCCACCAAGCCTTTCTCGAGAAAGGCTTGGTGGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-1226s1c1
Sequence:CCGGGCAGTCATGAAAGAGATCAAACTCGAGTTTGATCTCTTTCATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005157.3-2381s1c1
Sequence:CCGGCTGCTGATGAGGTCTTCAAAGCTCGAGCTTTGAAGACCTCATCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005157
VALIDATED
ABL1 MISSION shRNA Lentiviral Transduction Particles
c-abl oncogene 1, non-receptor tyrosine kinase
Human
29 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005157.3-1462s21c1
Sequence:CCGGGCTGAAATCCACCAAGCCTTTCTCGAGAAAGGCTTGGTGGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005157.3-865s21c1
Sequence:CCGGGCAGTCATGAAAGAGATCAAACTCGAGTTTGATCTCTTTCATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005157.3-3354s21c1
Sequence:CCGGCCTCAGTTCGGTGAAGGAAATCTCGAGATTTCCTTCACCGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005157.3-1127s21c1
Sequence:CCGGACTTGGTGAAGGTAGCTGATTCTCGAGAATCAGCTACCTTCACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005157.3-4458s21c1
Sequence:CCGGGAGTTCTTGAAGCATTTCAAACTCGAGTTTGAAATGCTTCAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-951s1c1
Sequence:CCGGCCGAGTTGGTTCATCATCATTCTCGAGAATGATGATGAACCAACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-1291s1c1
Sequence:CCGGCCCGTTCTATATCATCACTGACTCGAGTCAGTGATGATATAGAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-3369s1c1
Sequence:CCGGCCTTCATCCCTCTCATATCAACTCGAGTTGATATGAGAGGGATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-1234s1c1
Sequence:CCGGGAAAGAGATCAAACACCCTAACTCGAGTTAGGGTGTTTGATCTCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.x-3910s1c1
Sequence:CCGGCCAGCTCTACTACCTACGTTTCTCGAGAAACGTAGGTAGTAGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-4458s1c1
Sequence:CCGGGAGTTCTTGAAGCATTTCAAACTCGAGTTTGAAATGCTTCAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-3354s1c1
Sequence:CCGGCCTCAGTTCGGTGAAGGAAATCTCGAGATTTCCTTCACCGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-1287s1c1
Sequence:CCGGGCTTTGGGAAATTGCTACCTACTCGAGTAGGTAGCAATTTCCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005157.3-3274s1c1
Sequence:CCGGGAGAATAATCTCCGGGAGCTTCTCGAGAAGCTCCCGGAGATTATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005157.3-693s1c1
Sequence:CCGGCAACTACGACAAGTGGGAGATCTCGAGATCTCCCACTTGTCGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-224s1c1
Sequence:CCGGCCAGTGGAGATAACACTCTAACTCGAGTTAGAGTGTTATCTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-3002s1c1
Sequence:CCGGCCGCCTTCATCCCTCTCATATCTCGAGATATGAGAGGGATGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005157.3-267s1c1
Sequence:CCGGCCGGGTCTTAGGCTATAATCACTCGAGTGATTATAGCCTAAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-3204s1c1
Sequence:CCGGCGTGAGCTATGTGGATTCCATCTCGAGATGGAATCCACATAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005157.3-4388s1c1
Sequence:CCGGCCACTCCTCTAAGACAAAGTACTCGAGTACTTTGTCTTAGAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-2238s1c1
Sequence:CCGGACAGTTTGACTCGTCCACATTCTCGAGAATGTGGACGAGTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-1127s1c1
Sequence:CCGGACTTGGTGAAGGTAGCTGATTCTCGAGAATCAGCTACCTTCACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.3-93s1c1
Sequence:CCGGGCGGCCAGTAGCATCTGACTTCTCGAGAAGTCAGATGCTACTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-950s1c1
Sequence:CCGGGCCGAGTTGGTTCATCATCATCTCGAGATGATGATGAACCAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-716s1c1
Sequence:CCGGCCAGTCAACAGTCTGGAGAAACTCGAGTTTCTCCAGACTGTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-3620s1c1
Sequence:CCGGGCCATCAACAAACTGGAGAATCTCGAGATTCTCCAGTTTGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-1823s1c1
Sequence:CCGGGCTGAAATCCACCAAGCCTTTCTCGAGAAAGGCTTGGTGGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005157.2-1226s1c1
Sequence:CCGGGCAGTCATGAAAGAGATCAAACTCGAGTTTGATCTCTTTCATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005157.3-2381s1c1
Sequence:CCGGCTGCTGATGAGGTCTTCAAAGCTCGAGCTTTGAAGACCTCATCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007313
VALIDATED
ABL1 MISSION shRNA Bacterial Glycerol Stock
c-abl oncogene 1, non-receptor tyrosine kinase
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000010289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_007313.x-4969s1c1
Sequence:CCGGTAATTACCGTGAGTGACATAGCTCGAGCTATGTCACTCACGGTAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007313
VALIDATED
ABL1 MISSION shRNA shRNA Plasmid DNA
c-abl oncogene 1, non-receptor tyrosine kinase
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000010289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_007313.x-4969s1c1
Sequence:CCGGTAATTACCGTGAGTGACATAGCTCGAGCTATGTCACTCACGGTAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007313
VALIDATED
ABL1 MISSION shRNA Lentiviral Transduction Particles
c-abl oncogene 1, non-receptor tyrosine kinase
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000010289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_007313.x-4969s1c1
Sequence:CCGGTAATTACCGTGAGTGACATAGCTCGAGCTATGTCACTCACGGTAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks